sncRNA detail

ENST00000497519.1_681_769_+

Derived from ENST00000497519.1 Homo Sapiens

120 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RPL5-205
Gene
RPL5 (ENSG00000122406.14)
Precursor type
retained intron
Sequence
CTGAATGATGATATCCCACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATGATGCGATAATTGTTTCAAGACGGGACTGATG
Start
Start: 681
End
End: 769
Length
Length: 89
Expression (sum)
367792.00
Expression fraction
3.32
Expression (Avg non-zero)
3064.93
Expression (max)
21668.00
Expression (CPM sum)
9.42
Expression (CPM avg non-zero)
10.89
Expression (CPM max)
48.16
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RPL5-205
Transcript ID
ENST00000497519.1
Chromosome
chr1
Genomic start
92836610
Genomic end
92841862

Gene context

Gene name
RPL5
Gene ID
ENSG00000122406.14
Gene type
protein_coding

Expression table

Showing 120 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 96.00 0.03 9.84 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 1.00 0.00 0.08 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 5.00 0.03 0.31 100.00
ENCFF000JEH fibroblast of the aortic adventitia (Primary cell) 11.00 0.00 0.76 100.00
ENCFF000JEI fibroblast of the aortic adventitia (Primary cell) 37.00 0.01 1.96 100.00
ENCFF000JEU thoracic aorta endothelial cell (Primary cell) 20.00 0.01 1.53 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 19.00 0.01 1.71 100.00
ENCFF000JGN articular chondrocyte of knee joint (Primary cell) 5.00 0.00 0.47 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 21.00 0.01 2.23 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 69.00 0.02 3.67 100.00
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 41.00 0.01 1.68 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 43.00 0.03 14.32 100.00
ENCFF000JJV mesenchymal stem cell of adipose (Primary cell) 65.00 0.01 2.13 100.00
ENCFF000JKK mesenchymal stem cell of Wharton's jelly (Primary cell) 36.00 0.01 2.16 100.00
ENCFF000JKT mesenchymal stem cell of Wharton's jelly (Primary cell) 32.00 0.01 1.62 100.00
ENCFF000JKU osteoblast (Primary cell) 8.00 0.05 2.58 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 49.00 0.02 3.02 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 161.00 0.03 5.73 100.00
ENCFF000JLG osteoblast (Primary cell) 14.00 0.01 1.34 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 267.00 0.04 6.01 100.00
ENCFF000JLU placental pericyte (Primary cell) 39.00 0.04 4.78 100.00
ENCFF000JLV placental pericyte (Primary cell) 71.00 0.01 1.50 100.00
ENCFF000JMQ placental epithelial cell (Primary cell) 45.00 0.01 1.95 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 24.00 0.01 0.53 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 57.00 0.01 1.67 100.00
ENCFF000JNK vein endothelial cell (Primary cell) 14.00 0.00 0.40 100.00
ENCFF000JNS fibroblast of villous mesenchyme (Primary cell) 8.00 0.01 1.58 100.00
ENCFF000JOD fibroblast of villous mesenchyme (Primary cell) 10.00 0.01 1.55 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 31.00 0.01 0.81 100.00
ENCFF000JOR subcutaneous preadipocyte (Primary cell) 85.00 0.01 1.44 100.00
ENCFF000JQE IMR-90 (Cell line) 15.00 0.38 16.07 100.00
ENCFF000KCE fibroblast of dermis (Primary cell) 21.00 0.01 1.46 100.00
ENCFF000KCV fibroblast of dermis (Primary cell) 21.00 0.02 2.68 100.00
ENCFF000KEC melanocyte of skin (Primary cell) 38.00 0.02 3.36 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 28.00 0.02 2.44 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 23.00 0.01 1.13 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 42.00 0.02 2.74 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 15.00 0.01 1.61 100.00
ENCFF001REE GM12878 (Cell line) 147.00 3.54 0.38 100.00
ENCFF001REL K562 (Cell line) 2025.00 48.11 3.76 100.00
ENCFF001REQ K562 (Cell line) 691.00 28.25 1.75 100.00
ENCFF001RER GM12878 (Cell line) 976.00 20.13 2.02 100.00
ENCFF001RLS parietal lobe (Tissue) 7031.00 78.56 24.87 100.00
ENCFF001RLT temporal lobe (Tissue) 8084.00 66.98 13.42 100.00
ENCFF001RLU spinal cord (Tissue) 6845.00 78.50 23.25 100.00
ENCFF001RLV tongue (Tissue) 6498.00 74.16 17.63 100.00
ENCFF001RLW occipital lobe (Tissue) 4843.00 82.72 15.70 100.00
ENCFF001RLX spinal cord (Tissue) 12488.00 76.95 22.90 100.00
ENCFF001RLY diencephalon (Tissue) 2297.00 70.29 6.55 100.00
ENCFF001RLZ heart (Tissue) 5927.00 56.96 5.60 100.00
ENCFF001RMA skin of body (Tissue) 4864.00 68.18 11.98 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 5780.00 76.29 18.66 100.00
ENCFF001RMC temporal lobe (Tissue) 12096.00 74.33 24.76 100.00
ENCFF001RMD uterus (Tissue) 14206.00 74.31 23.50 100.00
ENCFF001RME occipital lobe (Tissue) 7267.00 83.67 15.38 100.00
ENCFF001RMF metanephros (Tissue) 4478.00 65.32 8.33 100.00
ENCFF001RMG parietal lobe (Tissue) 4967.00 75.67 21.11 100.00
ENCFF001RMH lung (Tissue) 4944.00 70.67 11.21 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 2115.00 71.50 9.17 100.00
ENCFF001RMJ skin of body (Tissue) 9381.00 80.04 24.39 100.00
ENCFF001RMK heart (Tissue) 3877.00 55.17 6.73 100.00
ENCFF001RML cerebellum (Tissue) 4032.00 71.94 7.46 100.00
ENCFF001RMM frontal cortex (Tissue) 4405.00 72.28 7.26 100.00
ENCFF001RMN uterus (Tissue) 12675.00 71.20 24.20 100.00
ENCFF001RMO cerebellum (Tissue) 2498.00 57.02 4.82 100.00
ENCFF001RMP frontal cortex (Tissue) 7043.00 76.52 11.24 100.00
ENCFF001RMQ lung (Tissue) 6881.00 68.47 10.36 100.00
ENCFF001RMR thyroid gland (Tissue) 21668.00 79.13 48.16 100.00
ENCFF001RMS diencephalon (Tissue) 4675.00 72.46 9.69 100.00
ENCFF001RMT thyroid gland (Tissue) 15692.00 69.81 20.70 100.00
ENCFF001RMU metanephros (Tissue) 7045.00 76.80 14.77 100.00
ENCFF001RMV tongue (Tissue) 8478.00 69.77 16.52 100.00
ENCFF001RTT urinary bladder (Tissue) 3542.00 67.25 9.55 100.00
ENCFF001RTU liver (Tissue) 2228.00 53.87 6.64 100.00
ENCFF004BLT GM23338 (Cell line) 4487.00 66.44 5.38 100.00
ENCFF004YAN Karpas-422 (Cell line) 363.00 12.22 2.53 100.00
ENCFF023EVA A375 (Cell line) 887.00 73.92 6.10 100.00
ENCFF059WHB prostate gland (Tissue) 3548.00 86.60 13.25 100.00
ENCFF062TYF GM23248 (Cell line) 3.00 5.45 0.13 100.00
ENCFF073SVL transverse colon (Tissue) 1302.00 52.58 6.24 100.00
ENCFF076JME ovary (Tissue) 2186.00 71.74 9.62 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 7200.00 84.95 13.14 100.00
ENCFF106XDA esophagus muscularis mucosa (Tissue) 808.00 72.53 3.62 100.00
ENCFF181JNF gastroesophageal sphincter (Tissue) 618.00 63.78 2.35 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 6091.00 69.53 5.02 100.00
ENCFF211GIU transverse colon (Tissue) 193.00 12.31 0.94 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 11483.00 78.58 8.56 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 14.00 1.89 0.06 100.00
ENCFF226BCZ Karpas-422 (Cell line) 780.00 24.44 5.15 100.00
ENCFF242SEA body of pancreas (Tissue) 1757.00 56.79 7.63 100.00
ENCFF274FTM prostate gland (Tissue) 1696.00 66.88 6.68 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 1.00 0.11 0.00 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 5442.00 75.16 6.39 100.00
ENCFF299ETH OCI-LY7 (Cell line) 825.00 40.70 8.55 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 2758.00 71.86 8.21 100.00
ENCFF381DXM transverse colon (Tissue) 241.00 18.58 0.94 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 4251.00 86.04 21.14 100.00
ENCFF450POH GM23338 (Cell line) 81.00 11.65 0.63 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 6370.00 88.74 21.00 100.00
ENCFF476SLG A375 (Cell line) 799.00 75.52 6.52 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 1.00 0.03 0.01 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 3702.00 85.99 14.63 100.00
ENCFF516CUT adrenal gland (Tissue) 3253.00 75.04 17.88 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 9877.00 81.47 8.27 100.00
ENCFF521RDG OCI-LY7 (Cell line) 1084.00 49.72 11.00 100.00
ENCFF540WGH HT-29 (Cell line) 837.00 79.19 10.04 100.00
ENCFF590YKZ GM23248 (Cell line) 9.00 6.16 0.18 100.00
ENCFF645FQS transverse colon (Tissue) 393.00 38.01 2.07 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 2385.00 70.37 9.71 100.00
ENCFF686BEE adrenal gland (Tissue) 5860.00 84.01 39.55 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 22.00 0.69 0.20 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 3209.00 79.20 9.84 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 625.00 62.88 4.16 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 3929.00 77.39 16.73 100.00
ENCFF834CUR HT-29 (Cell line) 621.00 74.55 8.19 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 7495.00 82.76 21.86 100.00
ENCFF908XAD omental fat pad (Tissue) 5071.00 76.93 11.95 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 7714.00 83.62 8.61 100.00
ENCFF993BFO body of pancreas (Tissue) 231.00 44.68 2.24 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 13014.00 80.42 7.90 100.00

RNA secondary structure