sncRNA detail

ENST00000516507.1_1_32_+

Derived from ENST00000516507.1 Homo Sapiens

112 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RNY4-201
Gene
RNY4 (ENSG00000252316.1)
Precursor type
misc RNA
Sequence
GGCTGGTCCGATGGTAGTGGGTTATCAGAACT
Start
Start: 1
End
End: 32
Length
Length: 32
Expression (sum)
13143376.00
Expression fraction
50.50
Expression (Avg non-zero)
117351.57
Expression (max)
620474.00
Expression (CPM sum)
332.15
Expression (CPM avg non-zero)
338.37
Expression (CPM max)
2776.65
Prominence
95.57

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RNY4-201
Transcript ID
ENST00000516507.1
Chromosome
chr7
Genomic start
148963315
Genomic end
148963410

Gene context

Gene name
RNY4
Gene ID
ENSG00000252316.1
Gene type
misc_RNA

Expression table

Showing 112 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 246011.00 50.91 634.43 98.83
ENCFF001REL K562 (Cell line) 40408.00 26.02 75.12 96.32
ENCFF001REQ K562 (Cell line) 25152.00 13.20 63.83 94.62
ENCFF001RER GM12878 (Cell line) 281801.00 55.81 582.03 98.99
ENCFF001RLS parietal lobe (Tissue) 188033.00 63.23 665.20 97.05
ENCFF001RLT temporal lobe (Tissue) 351982.00 71.24 584.24 97.69
ENCFF001RLU spinal cord (Tissue) 251382.00 71.27 854.00 97.79
ENCFF001RLV tongue (Tissue) 34140.00 28.96 92.61 96.48
ENCFF001RLW occipital lobe (Tissue) 83253.00 62.77 269.80 98.21
ENCFF001RLX spinal cord (Tissue) 433436.00 58.54 794.78 92.65
ENCFF001RLY diencephalon (Tissue) 468137.00 71.97 1335.55 97.65
ENCFF001RLZ heart (Tissue) 65911.00 32.05 62.27 97.41
ENCFF001RMA skin of body (Tissue) 132646.00 69.00 326.77 98.27
ENCFF001RMB skeletal muscle tissue (Tissue) 160241.00 68.18 517.19 98.48
ENCFF511CAA neuronal stem cell (In vitro differentiated cells) 46946.00 71.72 362.82 94.78
ENCFF001RMC temporal lobe (Tissue) 288583.00 55.52 590.66 97.35
ENCFF001RMD uterus (Tissue) 116622.00 56.09 192.93 96.99
ENCFF001RME occipital lobe (Tissue) 110080.00 59.98 233.02 98.28
ENCFF001RMF metanephros (Tissue) 19145.00 27.18 35.62 96.92
ENCFF001RMG parietal lobe (Tissue) 72620.00 40.55 308.66 97.73
ENCFF001RMH lung (Tissue) 102265.00 42.03 231.91 95.90
ENCFF001RMI skeletal muscle tissue (Tissue) 65049.00 65.04 282.11 98.21
ENCFF001RMJ skin of body (Tissue) 104328.00 57.10 271.26 97.99
ENCFF001RMK heart (Tissue) 190224.00 60.66 330.11 95.43
ENCFF001RML cerebellum (Tissue) 251306.00 58.33 464.82 97.88
ENCFF001RMM frontal cortex (Tissue) 183395.00 68.23 302.23 97.90
ENCFF001RMN uterus (Tissue) 45552.00 27.59 86.98 97.38
ENCFF001RMO cerebellum (Tissue) 189400.00 48.41 365.68 92.34
ENCFF001RMP frontal cortex (Tissue) 297799.00 75.38 475.24 98.05
ENCFF001RMQ lung (Tissue) 140165.00 48.22 211.01 97.70
ENCFF001RMR thyroid gland (Tissue) 170477.00 47.94 378.94 91.85
ENCFF001RMS diencephalon (Tissue) 560183.00 76.63 1161.55 98.20
ENCFF001RMT thyroid gland (Tissue) 88071.00 50.11 116.17 97.22
ENCFF001RMU metanephros (Tissue) 69898.00 51.77 146.59 96.00
ENCFF001RMV tongue (Tissue) 65611.00 40.60 127.88 96.13
ENCFF001RTT urinary bladder (Tissue) 82003.00 41.40 220.99 98.14
ENCFF001RTU liver (Tissue) 60210.00 33.18 179.49 95.33
ENCFF004BLT GM23338 (Cell line) 21414.00 31.39 25.70 92.45
ENCFF004YAN Karpas-422 (Cell line) 79638.00 31.25 554.98 97.36
ENCFF015UJX spleen (Tissue) 131359.00 66.29 740.30 98.66
ENCFF023EVA A375 (Cell line) 2058.00 4.00 14.16 95.90
ENCFF059WHB prostate gland (Tissue) 456422.00 89.04 1704.55 99.69
ENCFF062TYF GM23248 (Cell line) 1216.00 15.78 52.06 92.61
ENCFF073SVL transverse colon (Tissue) 141377.00 70.72 677.80 99.10
ENCFF076JME ovary (Tissue) 19625.00 18.61 86.40 76.22
ENCFF081QYT esophagus squamous epithelium (Tissue) 32636.00 30.59 59.57 97.65
ENCFF106XDA esophagus muscularis mucosa (Tissue) 620474.00 60.32 2776.65 82.54
ENCFF158HXL right lobe of liver (Tissue) 21446.00 38.66 183.67 95.58
ENCFF181JNF gastroesophageal sphincter (Tissue) 503214.00 55.23 1913.37 90.89
ENCFF192PKY upper lobe of left lung (Tissue) 158444.00 59.25 955.44 92.87
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 44917.00 42.05 37.05 96.00
ENCFF195CBI testis (Tissue) 11229.00 25.02 55.93 98.86
ENCFF211GIU transverse colon (Tissue) 132471.00 60.62 646.92 97.40
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 175439.00 36.74 130.76 97.53
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 132861.00 78.26 599.78 88.57
ENCFF226BCZ Karpas-422 (Cell line) 93050.00 38.36 614.24 97.25
ENCFF242SEA body of pancreas (Tissue) 23073.00 10.33 100.16 97.55
ENCFF261XRS stomach (Tissue) 87062.00 36.06 424.19 99.00
ENCFF274FTM prostate gland (Tissue) 165490.00 76.57 651.65 97.18
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 77879.00 74.75 372.65 87.43
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 114595.00 33.49 134.53 97.31
ENCFF299ETH OCI-LY7 (Cell line) 7122.00 7.60 73.79 98.52
ENCFF310THB vagina (Tissue) 152033.00 53.94 628.71 99.23
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 35035.00 65.81 224.92 93.98
ENCFF338AVU gastroesophageal sphincter (Tissue) 212108.00 27.16 631.56 98.62
ENCFF379KTQ stomach (Tissue) 67998.00 40.64 307.61 99.37
ENCFF381DXM transverse colon (Tissue) 60864.00 39.04 236.33 99.09
ENCFF400GBK spleen (Tissue) 153407.00 70.56 756.81 99.21
ENCFF429ILE esophagus squamous epithelium (Tissue) 21620.00 13.67 107.50 97.51
ENCFF450POH GM23338 (Cell line) 7474.00 20.43 57.79 91.75
ENCFF476IAU esophagus squamous epithelium (Tissue) 30659.00 24.72 101.07 99.05
ENCFF476SLG A375 (Cell line) 1947.00 4.39 15.89 95.11
ENCFF478BJL testis (Tissue) 3358.00 22.35 21.04 94.30
ENCFF495VAK Peyer's patch (Tissue) 43386.00 73.51 86.39 98.83
ENCFF503PBD mesendoderm (In vitro differentiated cells) 13458.00 60.15 127.60 94.39
ENCFF510IHL esophagus squamous epithelium (Tissue) 83182.00 39.09 328.82 82.41
ENCFF516CUT adrenal gland (Tissue) 33874.00 36.28 186.16 97.28
ENCFF518LYU hepatocyte (In vitro differentiated cells) 96915.00 61.10 81.19 98.74
ENCFF521RDG OCI-LY7 (Cell line) 7546.00 9.15 76.60 98.14
ENCFF534JKI spleen (Tissue) 83206.00 68.05 344.81 98.87
ENCFF540WGH HT-29 (Cell line) 1300.00 11.16 15.60 94.55
ENCFF546NNZ uterus (Tissue) 54881.00 13.63 273.80 62.06
ENCFF551ARD thyroid gland (Tissue) 199111.00 74.85 1345.92 92.65
ENCFF574WUG right lobe of liver (Tissue) 28359.00 45.54 236.54 94.86
ENCFF583SZV stomach (Tissue) 181050.00 44.35 778.77 91.99
ENCFF590YKZ GM23248 (Cell line) 2312.00 34.12 45.18 93.34
ENCFF625OBY sigmoid colon (Tissue) 110425.00 50.60 646.80 97.56
ENCFF631JZF sigmoid colon (Tissue) 521549.00 85.85 2429.14 96.64
ENCFF643IED upper lobe of left lung (Tissue) 53741.00 27.71 397.54 98.35
ENCFF645FQS transverse colon (Tissue) 59619.00 47.27 313.82 98.67
ENCFF655CDV sigmoid colon (Tissue) 146655.00 46.76 533.44 97.91
ENCFF657CXK esophagus muscularis mucosa (Tissue) 89023.00 46.62 362.38 97.54
ENCFF682YQJ spleen (Tissue) 97619.00 65.20 475.35 97.19
ENCFF685KEG stomach (Tissue) 49713.00 25.28 284.85 98.10
ENCFF686BEE adrenal gland (Tissue) 20409.00 22.81 137.73 90.34
ENCFF694VGD upper lobe of left lung (Tissue) 53940.00 73.54 303.42 99.58
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 28859.00 66.48 191.17 93.85
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 11594.00 53.66 106.49 95.15
ENCFF728EUS sigmoid colon (Tissue) 181737.00 50.48 1169.15 98.07
ENCFF744HOK gastroesophageal sphincter (Tissue) 76744.00 21.19 235.21 98.49
ENCFF768XBE upper lobe of left lung (Tissue) 87857.00 66.44 633.53 97.80
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 59461.00 47.66 396.24 97.91
ENCFF800ZUT tibial nerve (Tissue) 111546.00 29.98 927.00 98.12
ENCFF811DGS gastroesophageal sphincter (Tissue) 92723.00 18.37 394.84 98.93
ENCFF834CUR HT-29 (Cell line) 948.00 7.66 12.50 94.52
ENCFF853XSN Peyer's patch (Tissue) 26397.00 49.03 79.75 99.12
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 61366.00 13.48 179.01 97.87
ENCFF908XAD omental fat pad (Tissue) 121263.00 57.15 285.66 98.59
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 53642.00 74.13 390.66 94.53
ENCFF964DUY hepatocyte (In vitro differentiated cells) 70557.00 61.88 78.79 98.41
ENCFF993BFO body of pancreas (Tissue) 8200.00 26.32 79.50 97.71
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 35730.00 35.16 21.68 96.62

RNA secondary structure