sncRNA detail

ENST00000488946.1_148_235_+

Derived from ENST00000488946.1 • Homo Sapiens

103 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RPL13A-212
Gene
RPL13A (ENSG00000142541.18)
Precursor type
retained intron
Sequence
CGCTGGAGGTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACGGCCATGAGATCAACCCCATGCACCGCTCTGAGACCT
Start
Start: 148
End
End: 235
Length
Length: 88
Expression (sum)
998818.00
Expression fraction
4.98
Expression (Avg non-zero)
9697.26
Expression (max)
117529.00
Expression (CPM sum)
25.32
Expression (CPM avg non-zero)
33.58
Expression (CPM max)
7256.44
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RPL13A-212
Transcript ID
ENST00000488946.1
Chromosome
chr19
Genomic start
49487608
Genomic end
49492305

Gene context

Gene name
RPL13A
Gene ID
ENSG00000142541.18
Gene type
protein_coding

Expression table

Showing 103 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 12585.00 58.45 1289.41 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 114086.00 77.48 9544.96 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 117529.00 78.75 7256.44 100.00
ENCFF000JEH fibroblast of the aortic adventitia (Primary cell) 9357.00 66.02 642.61 100.00
ENCFF000JEI fibroblast of the aortic adventitia (Primary cell) 17365.00 71.52 917.74 100.00
ENCFF000JEU thoracic aorta endothelial cell (Primary cell) 12095.00 80.39 926.75 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 24819.00 83.90 2231.28 100.00
ENCFF000JFN articular chondrocyte of knee joint (Primary cell) 14267.00 79.94 1223.75 100.00
ENCFF000JGN articular chondrocyte of knee joint (Primary cell) 21309.00 86.51 2005.54 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 25422.00 86.39 2694.40 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 38024.00 90.99 2020.16 100.00
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 51320.00 87.15 2105.28 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 2921.00 86.37 973.03 100.00
ENCFF000JJV mesenchymal stem cell of adipose (Primary cell) 65035.00 90.68 2131.25 100.00
ENCFF000JKK mesenchymal stem cell of Wharton's jelly (Primary cell) 14200.00 77.22 851.64 100.00
ENCFF000JKT mesenchymal stem cell of Wharton's jelly (Primary cell) 14932.00 72.22 758.20 100.00
ENCFF000JKU osteoblast (Primary cell) 2511.00 79.19 811.31 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 22981.00 89.87 1418.19 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 49309.00 76.07 1756.43 100.00
ENCFF000JLG osteoblast (Primary cell) 9563.00 79.97 916.78 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 33815.00 59.47 761.03 100.00
ENCFF000JLU placental pericyte (Primary cell) 6120.00 71.76 749.50 100.00
ENCFF000JLV placental pericyte (Primary cell) 26956.00 79.49 569.45 100.00
ENCFF000JMQ placental epithelial cell (Primary cell) 11635.00 73.30 503.79 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 27615.00 76.02 608.64 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 24780.00 40.41 727.42 100.00
ENCFF000JNK vein endothelial cell (Primary cell) 22804.00 79.37 647.33 100.00
ENCFF000JNS fibroblast of villous mesenchyme (Primary cell) 4944.00 81.41 975.47 100.00
ENCFF000JOD fibroblast of villous mesenchyme (Primary cell) 5903.00 88.73 912.06 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 30284.00 82.90 789.14 100.00
ENCFF000JOR subcutaneous preadipocyte (Primary cell) 46399.00 84.18 787.71 100.00
ENCFF000JQC IMR-90 (Cell line) 2773.00 93.59 4755.40 100.00
ENCFF000JQE IMR-90 (Cell line) 3436.00 93.37 3681.55 100.00
ENCFF000KCE fibroblast of dermis (Primary cell) 12880.00 81.91 896.07 100.00
ENCFF000KCV fibroblast of dermis (Primary cell) 10190.00 84.83 1301.26 100.00
ENCFF000KEC melanocyte of skin (Primary cell) 17645.00 83.51 1561.59 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 10123.00 75.32 883.56 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 23478.00 76.53 1151.86 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 11671.00 72.06 760.32 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 8891.00 86.16 956.49 100.00
ENCFF000KHC SK-N-SH (Cell line) 12434.00 90.83 4172.75 100.00
ENCFF000KIC SK-N-SH (Cell line) 3939.00 90.97 1049.67 100.00
ENCFF001REE GM12878 (Cell line) 5.00 0.00 0.01 100.00
ENCFF001REL K562 (Cell line) 4.00 0.00 0.01 100.00
ENCFF001REQ K562 (Cell line) 9.00 0.00 0.02 100.00
ENCFF001RER GM12878 (Cell line) 12.00 0.00 0.02 100.00
ENCFF001RLS parietal lobe (Tissue) 2.00 0.00 0.01 100.00
ENCFF001RLT temporal lobe (Tissue) 18.00 0.01 0.03 100.00
ENCFF001RLU spinal cord (Tissue) 5.00 0.00 0.02 100.00
ENCFF001RLV tongue (Tissue) 5.00 0.00 0.01 100.00
ENCFF001RLW occipital lobe (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RLX spinal cord (Tissue) 11.00 0.00 0.02 100.00
ENCFF001RLY diencephalon (Tissue) 4.00 0.00 0.01 100.00
ENCFF001RLZ heart (Tissue) 16.00 0.00 0.02 100.00
ENCFF001RMA skin of body (Tissue) 10.00 0.00 0.02 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RMC temporal lobe (Tissue) 10.00 0.00 0.02 100.00
ENCFF001RMD uterus (Tissue) 25.00 0.00 0.04 100.00
ENCFF001RME occipital lobe (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RMF metanephros (Tissue) 12.00 0.00 0.02 100.00
ENCFF001RMG parietal lobe (Tissue) 5.00 0.00 0.02 100.00
ENCFF001RMH lung (Tissue) 4.00 0.00 0.01 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 7.00 0.00 0.03 100.00
ENCFF001RMJ skin of body (Tissue) 12.00 0.00 0.03 100.00
ENCFF001RMK heart (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RML cerebellum (Tissue) 5.00 0.00 0.01 100.00
ENCFF001RMM frontal cortex (Tissue) 5.00 0.00 0.01 100.00
ENCFF001RMN uterus (Tissue) 18.00 0.00 0.03 100.00
ENCFF001RMO cerebellum (Tissue) 4.00 0.00 0.01 100.00
ENCFF001RMP frontal cortex (Tissue) 6.00 0.00 0.01 100.00
ENCFF001RMQ lung (Tissue) 9.00 0.00 0.01 100.00
ENCFF001RMR thyroid gland (Tissue) 15.00 0.00 0.03 100.00
ENCFF001RMS diencephalon (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMT thyroid gland (Tissue) 14.00 0.00 0.02 100.00
ENCFF001RMU metanephros (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RMV tongue (Tissue) 10.00 0.00 0.02 100.00
ENCFF001RTT urinary bladder (Tissue) 9.00 0.00 0.02 100.00
ENCFF001RTU liver (Tissue) 6.00 0.00 0.02 100.00
ENCFF004BLT GM23338 (Cell line) 6.00 0.00 0.01 100.00
ENCFF004YAN Karpas-422 (Cell line) 7.00 0.00 0.05 100.00
ENCFF023EVA A375 (Cell line) 3.00 0.00 0.02 100.00
ENCFF076JME ovary (Tissue) 3.00 0.01 0.01 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 6.00 0.00 0.01 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 13.00 0.00 0.01 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 12.00 0.00 0.01 100.00
ENCFF226BCZ Karpas-422 (Cell line) 2.00 0.00 0.01 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 19.00 0.00 0.02 100.00
ENCFF299ETH OCI-LY7 (Cell line) 4.00 0.00 0.04 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 8.00 0.01 0.04 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 8.00 0.00 0.03 100.00
ENCFF476SLG A375 (Cell line) 2.00 0.00 0.02 100.00
ENCFF516CUT adrenal gland (Tissue) 5.00 0.00 0.03 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 14.00 0.00 0.01 100.00
ENCFF521RDG OCI-LY7 (Cell line) 1.00 0.00 0.01 100.00
ENCFF540WGH HT-29 (Cell line) 1.00 0.00 0.01 100.00
ENCFF686BEE adrenal gland (Tissue) 8.00 0.01 0.05 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 7.00 0.01 0.02 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 14.00 0.03 0.06 100.00
ENCFF834CUR HT-29 (Cell line) 2.00 0.00 0.03 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 4.00 0.00 0.01 100.00
ENCFF908XAD omental fat pad (Tissue) 4.00 0.00 0.01 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 11.00 0.00 0.01 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 18.00 0.00 0.01 100.00

RNA secondary structure