sncRNA detail

ENST00000261038.6_3100_3122_+

Derived from ENST00000261038.6 • Homo Sapiens

80 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
SLC49A4-201
Gene
SLC49A4 (ENSG00000138463.9)
Precursor type
protein coding
Sequence
CTTCTAAGACCCTAACTTGTGAA
Start
Start: 3100
End
End: 3122
Length
Length: 23
Expression (sum)
291664.00
Expression fraction
95.16
Expression (Avg non-zero)
3645.80
Expression (max)
68933.00
Expression (CPM sum)
7.47
Expression (CPM avg non-zero)
8.90
Expression (CPM max)
113.60
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
SLC49A4-201
Transcript ID
ENST00000261038.6
Chromosome
chr3
Genomic start
122795069
Genomic end
122881139

Gene context

Gene name
SLC49A4
Gene ID
ENSG00000138463.9
Gene type
protein_coding

Expression table

Showing 80 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001RER GM12878 (Cell line) 1.00 1.89 0.00 100.00
ENCFF001RLS parietal lobe (Tissue) 4081.00 92.14 14.44 100.00
ENCFF001RLT temporal lobe (Tissue) 8713.00 86.83 14.46 100.00
ENCFF001RLU spinal cord (Tissue) 820.00 86.86 2.79 100.00
ENCFF001RLV tongue (Tissue) 104.00 57.14 0.28 100.00
ENCFF001RLW occipital lobe (Tissue) 13952.00 97.16 45.22 100.00
ENCFF001RLX spinal cord (Tissue) 1332.00 86.95 2.44 100.00
ENCFF001RLY diencephalon (Tissue) 22566.00 97.07 64.38 100.00
ENCFF001RLZ heart (Tissue) 4222.00 95.20 3.99 100.00
ENCFF001RMA skin of body (Tissue) 414.00 84.66 1.02 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 304.00 83.06 0.98 100.00
ENCFF001RMC temporal lobe (Tissue) 7105.00 87.33 14.54 100.00
ENCFF001RMD uterus (Tissue) 706.00 79.42 1.17 100.00
ENCFF001RME occipital lobe (Tissue) 27389.00 97.28 57.98 100.00
ENCFF001RMF metanephros (Tissue) 1715.00 94.39 3.19 100.00
ENCFF001RMG parietal lobe (Tissue) 3168.00 93.81 13.47 100.00
ENCFF001RMH lung (Tissue) 1251.00 91.38 2.84 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 166.00 82.18 0.72 100.00
ENCFF001RMJ skin of body (Tissue) 269.00 87.34 0.70 100.00
ENCFF001RMK heart (Tissue) 3577.00 96.03 6.21 100.00
ENCFF001RML cerebellum (Tissue) 11965.00 94.96 22.13 100.00
ENCFF001RMM frontal cortex (Tissue) 68933.00 97.44 113.60 100.00
ENCFF001RMN uterus (Tissue) 702.00 76.97 1.34 100.00
ENCFF001RMO cerebellum (Tissue) 4350.00 95.52 8.40 100.00
ENCFF001RMP frontal cortex (Tissue) 47881.00 97.06 76.41 100.00
ENCFF001RMQ lung (Tissue) 3170.00 93.84 4.77 100.00
ENCFF001RMR thyroid gland (Tissue) 296.00 76.88 0.66 100.00
ENCFF001RMS diencephalon (Tissue) 45616.00 96.71 94.59 100.00
ENCFF001RMT thyroid gland (Tissue) 504.00 79.12 0.66 100.00
ENCFF001RMU metanephros (Tissue) 1702.00 94.92 3.57 100.00
ENCFF001RMV tongue (Tissue) 218.00 57.98 0.42 100.00
ENCFF001RTT urinary bladder (Tissue) 3561.00 93.32 9.60 100.00
ENCFF001RTU liver (Tissue) 299.00 90.61 0.89 100.00
ENCFF004BLT GM23338 (Cell line) 1.00 5.26 0.00 100.00
ENCFF023EVA A375 (Cell line) 9.00 69.23 0.06 100.00
ENCFF059WHB prostate gland (Tissue) 1.00 8.33 0.00 100.00
ENCFF062TYF GM23248 (Cell line) 28.00 90.32 1.20 100.00
ENCFF076JME ovary (Tissue) 11.00 18.64 0.05 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 4.00 9.30 0.01 100.00
ENCFF106XDA esophagus muscularis mucosa (Tissue) 1.00 33.33 0.00 100.00
ENCFF181JNF gastroesophageal sphincter (Tissue) 3.00 15.79 0.01 100.00
ENCFF192PKY upper lobe of left lung (Tissue) 1.00 11.11 0.01 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 1.00 10.00 0.00 100.00
ENCFF195CBI testis (Tissue) 3.00 16.67 0.01 100.00
ENCFF211GIU transverse colon (Tissue) 2.00 7.41 0.01 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 2.00 1.54 0.00 100.00
ENCFF261XRS stomach (Tissue) 2.00 50.00 0.01 100.00
ENCFF274FTM prostate gland (Tissue) 8.00 22.86 0.03 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 1.00 6.67 0.00 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 3.00 3.49 0.00 100.00
ENCFF310THB vagina (Tissue) 5.00 23.81 0.02 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 10.00 14.71 0.03 100.00
ENCFF381DXM transverse colon (Tissue) 1.00 12.50 0.00 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 3.00 10.71 0.01 100.00
ENCFF450POH GM23338 (Cell line) 1.00 4.17 0.01 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 2.00 8.70 0.01 100.00
ENCFF476SLG A375 (Cell line) 8.00 80.00 0.07 100.00
ENCFF495VAK Peyer's patch (Tissue) 1.00 20.00 0.00 100.00
ENCFF516CUT adrenal gland (Tissue) 3.00 8.33 0.02 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 238.00 68.59 0.20 100.00
ENCFF546NNZ uterus (Tissue) 2.00 15.38 0.01 100.00
ENCFF551ARD thyroid gland (Tissue) 2.00 22.22 0.01 100.00
ENCFF583SZV stomach (Tissue) 6.00 26.09 0.03 100.00
ENCFF590YKZ GM23248 (Cell line) 67.00 91.78 1.31 100.00
ENCFF625OBY sigmoid colon (Tissue) 1.00 7.69 0.01 100.00
ENCFF643IED upper lobe of left lung (Tissue) 3.00 12.50 0.02 100.00
ENCFF645FQS transverse colon (Tissue) 3.00 9.68 0.02 100.00
ENCFF655CDV sigmoid colon (Tissue) 3.00 12.50 0.01 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 10.00 35.71 0.04 100.00
ENCFF685KEG stomach (Tissue) 4.00 12.50 0.02 100.00
ENCFF728EUS sigmoid colon (Tissue) 3.00 16.67 0.02 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 4.00 6.25 0.01 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 1.00 2.86 0.01 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 1.00 4.76 0.01 100.00
ENCFF800ZUT tibial nerve (Tissue) 3.00 8.33 0.02 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 4.00 14.81 0.02 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 2.00 3.64 0.01 100.00
ENCFF908XAD omental fat pad (Tissue) 4.00 7.84 0.01 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 135.00 66.83 0.15 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 1.00 50.00 0.00 100.00

RNA secondary structure