sncRNA detail

ENST00000655965.1_2745_2837_+

Derived from ENST00000655965.1 • Homo Sapiens

84 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
SNHG14-241
Gene
SNHG14 (ENSG00000224078.16)
Precursor type
lncRNA
Sequence
GATCGATGATGAGTCCCCCATAAAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCATACCGTCGTTCTCATCGGAACTGAGGTC
Start
Start: 2745
End
End: 2837
Length
Length: 93
Expression (sum)
1406397.00
Expression fraction
28.23
Expression (Avg non-zero)
16742.82
Expression (max)
97237.00
Expression (CPM sum)
35.60
Expression (CPM avg non-zero)
42.60
Expression (CPM max)
161.40
Prominence
94.72

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
SNHG14-241
Transcript ID
ENST00000655965.1
Chromosome
chr15
Genomic start
25041974
Genomic end
25056953

Gene context

Gene name
SNHG14
Gene ID
ENSG00000224078.16
Gene type
lncRNA

Expression table

Showing 84 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000JEC neural cell (In vitro differentiated cells) 22.00 0.60 1.84 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 3.00 0.10 0.19 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 2.00 1.27 0.06 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 4.00 5.63 0.20 100.00
ENCFF001REE GM12878 (Cell line) 35.00 3.21 0.09 100.00
ENCFF001REL K562 (Cell line) 3.00 12.00 0.01 100.00
ENCFF001REQ K562 (Cell line) 2.00 6.90 0.01 100.00
ENCFF001RER GM12878 (Cell line) 167.00 10.61 0.34 98.24
ENCFF001RLS parietal lobe (Tissue) 51737.00 31.42 183.03 95.86
ENCFF001RLT temporal lobe (Tissue) 97237.00 32.80 161.40 97.13
ENCFF001RLU spinal cord (Tissue) 40842.00 26.63 138.75 95.49
ENCFF001RLV tongue (Tissue) 16420.00 40.32 44.54 88.47
ENCFF001RLW occipital lobe (Tissue) 24634.00 28.25 79.83 92.45
ENCFF001RLX spinal cord (Tissue) 43425.00 24.24 79.63 96.39
ENCFF001RLY diencephalon (Tissue) 55606.00 19.92 158.64 92.87
ENCFF001RLZ heart (Tissue) 53995.00 38.84 51.01 97.16
ENCFF001RMA skin of body (Tissue) 7424.00 38.82 18.29 93.93
ENCFF001RMB skeletal muscle tissue (Tissue) 11716.00 43.28 37.81 93.15
ENCFF001RMC temporal lobe (Tissue) 60768.00 27.41 124.38 96.93
ENCFF001RMD uterus (Tissue) 23491.00 30.10 38.86 90.46
ENCFF001RME occipital lobe (Tissue) 36066.00 29.02 76.35 92.18
ENCFF001RMF metanephros (Tissue) 24478.00 39.55 45.54 94.78
ENCFF001RMG parietal lobe (Tissue) 42685.00 36.90 181.43 96.64
ENCFF001RMH lung (Tissue) 20862.00 36.71 47.31 90.62
ENCFF001RMI skeletal muscle tissue (Tissue) 12663.00 46.82 54.92 94.59
ENCFF001RMJ skin of body (Tissue) 8020.00 47.07 20.85 89.50
ENCFF001RMK heart (Tissue) 26994.00 40.31 46.85 96.84
ENCFF001RML cerebellum (Tissue) 38962.00 19.12 72.06 94.42
ENCFF001RMM frontal cortex (Tissue) 54788.00 20.83 90.29 95.33
ENCFF001RMN uterus (Tissue) 13169.00 29.53 25.15 95.12
ENCFF001RMO cerebellum (Tissue) 23727.00 20.74 45.81 93.71
ENCFF001RMP frontal cortex (Tissue) 83708.00 31.85 133.58 95.11
ENCFF001RMQ lung (Tissue) 46826.00 37.32 70.50 93.07
ENCFF001RMR thyroid gland (Tissue) 13820.00 45.55 30.72 96.28
ENCFF001RMS diencephalon (Tissue) 91831.00 22.19 190.41 94.35
ENCFF001RMT thyroid gland (Tissue) 21601.00 38.01 28.49 93.41
ENCFF001RMU metanephros (Tissue) 14820.00 41.79 31.08 91.12
ENCFF001RMV tongue (Tissue) 26106.00 40.56 50.88 91.81
ENCFF001RTT urinary bladder (Tissue) 12050.00 35.79 32.47 93.30
ENCFF001RTU liver (Tissue) 17593.00 30.34 52.44 90.87
ENCFF004BLT GM23338 (Cell line) 8133.00 19.21 9.76 99.89
ENCFF004YAN Karpas-422 (Cell line) 692.00 14.45 4.82 99.43
ENCFF023EVA A375 (Cell line) 1286.00 38.14 8.85 98.85
ENCFF059WHB prostate gland (Tissue) 8707.00 48.41 32.52 80.12
ENCFF073SVL transverse colon (Tissue) 4093.00 62.36 19.62 94.90
ENCFF076JME ovary (Tissue) 8294.00 53.75 36.52 92.55
ENCFF081QYT esophagus squamous epithelium (Tissue) 4802.00 43.76 8.77 90.50
ENCFF106XDA esophagus muscularis mucosa (Tissue) 3401.00 56.92 15.22 91.75
ENCFF181JNF gastroesophageal sphincter (Tissue) 691.00 17.51 2.63 94.79
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 36276.00 23.31 29.92 99.08
ENCFF211GIU transverse colon (Tissue) 646.00 39.10 3.15 91.50
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 18384.00 26.11 13.70 98.62
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 18.00 1.00 0.08 100.00
ENCFF226BCZ Karpas-422 (Cell line) 1177.00 19.90 7.77 98.49
ENCFF242SEA body of pancreas (Tissue) 5056.00 44.83 21.95 86.41
ENCFF274FTM prostate gland (Tissue) 4413.00 44.04 17.38 88.47
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 15027.00 24.32 17.64 97.57
ENCFF299ETH OCI-LY7 (Cell line) 1.00 100.00 0.01 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 9449.00 39.11 28.13 88.35
ENCFF381DXM transverse colon (Tissue) 807.00 48.67 3.13 97.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 1998.00 65.19 9.93 97.85
ENCFF450POH GM23338 (Cell line) 358.00 8.86 2.77 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 1285.00 58.84 4.24 88.56
ENCFF476SLG A375 (Cell line) 916.00 33.22 7.48 98.81
ENCFF503PBD mesendoderm (In vitro differentiated cells) 4.00 0.05 0.04 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 1364.00 54.32 5.39 93.62
ENCFF516CUT adrenal gland (Tissue) 8865.00 64.20 48.72 94.10
ENCFF518LYU hepatocyte (In vitro differentiated cells) 37746.00 30.85 31.62 95.20
ENCFF521RDG OCI-LY7 (Cell line) 1.00 25.00 0.01 100.00
ENCFF590YKZ GM23248 (Cell line) 3.00 1.08 0.06 100.00
ENCFF645FQS transverse colon (Tissue) 1834.00 60.75 9.65 97.29
ENCFF657CXK esophagus muscularis mucosa (Tissue) 7788.00 60.63 31.70 90.66
ENCFF686BEE adrenal gland (Tissue) 11756.00 73.58 79.34 93.78
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 4.00 0.06 0.03 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 225.00 2.37 2.07 97.83
ENCFF744HOK gastroesophageal sphincter (Tissue) 3066.00 24.90 9.40 92.74
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 2747.00 52.70 18.31 90.07
ENCFF811DGS gastroesophageal sphincter (Tissue) 3291.00 30.11 14.01 93.65
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 1788.00 41.69 5.22 89.80
ENCFF908XAD omental fat pad (Tissue) 2494.00 52.88 5.88 93.09
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 3.00 0.04 0.02 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 25015.00 27.01 27.93 96.01
ENCFF993BFO body of pancreas (Tissue) 185.00 10.42 1.79 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 44006.00 24.51 26.70 99.61

RNA secondary structure