sncRNA detail

ENST00000388006.1_7_28_+

Derived from ENST00000388006.1 • Homo Sapiens

83 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
MIR196A1-201
Gene
MIR196A1 (ENSG00000210741.1)
Precursor type
miRNA
Sequence
TAGGTAGTTTCATGTTGTTGGG
Start
Start: 7
End
End: 28
Length
Length: 22
Expression (sum)
55274.00
Expression fraction
58.26
Expression (Avg non-zero)
665.95
Expression (max)
8212.00
Expression (CPM sum)
1.52
Expression (CPM avg non-zero)
1.91
Expression (CPM max)
15.06
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
MIR196A1-201
Transcript ID
ENST00000388006.1
Chromosome
chr17
Genomic start
48632490
Genomic end
48632559

Gene context

Gene name
MIR196A1
Gene ID
ENSG00000210741.1
Gene type
miRNA

Expression table

Showing 83 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 3.00 42.86 0.01 100.00
ENCFF001REL K562 (Cell line) 331.00 66.33 0.62 100.00
ENCFF001REQ K562 (Cell line) 260.00 56.28 0.66 100.00
ENCFF001RER GM12878 (Cell line) 4.00 40.00 0.01 100.00
ENCFF001RLT temporal lobe (Tissue) 4.00 57.14 0.01 100.00
ENCFF001RLU spinal cord (Tissue) 4762.00 64.00 16.18 100.00
ENCFF001RLV tongue (Tissue) 1.00 33.33 0.00 100.00
ENCFF001RLW occipital lobe (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RLX spinal cord (Tissue) 8212.00 67.66 15.06 100.00
ENCFF001RMA skin of body (Tissue) 2248.00 53.26 5.54 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 3979.00 59.55 12.84 100.00
ENCFF001RMC temporal lobe (Tissue) 3.00 100.00 0.01 100.00
ENCFF001RMD uterus (Tissue) 3885.00 52.79 6.43 100.00
ENCFF001RME occipital lobe (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RMF metanephros (Tissue) 4981.00 61.03 9.27 100.00
ENCFF001RMH lung (Tissue) 10.00 76.92 0.02 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 1685.00 58.28 7.31 100.00
ENCFF001RMJ skin of body (Tissue) 2865.00 62.20 7.45 100.00
ENCFF001RML cerebellum (Tissue) 14.00 66.67 0.03 100.00
ENCFF001RMN uterus (Tissue) 3427.00 56.30 6.54 100.00
ENCFF001RMO cerebellum (Tissue) 3.00 60.00 0.01 100.00
ENCFF001RMQ lung (Tissue) 6.00 60.00 0.01 100.00
ENCFF001RMR thyroid gland (Tissue) 227.00 57.91 0.50 100.00
ENCFF001RMS diencephalon (Tissue) 4.00 100.00 0.01 100.00
ENCFF001RMT thyroid gland (Tissue) 25.00 53.19 0.03 100.00
ENCFF001RMU metanephros (Tissue) 8073.00 58.76 16.93 100.00
ENCFF001RMV tongue (Tissue) 2.00 22.22 0.00 100.00
ENCFF001RTT urinary bladder (Tissue) 1611.00 60.86 4.34 100.00
ENCFF001RTU liver (Tissue) 4.00 100.00 0.01 100.00
ENCFF004BLT GM23338 (Cell line) 1.00 100.00 0.00 100.00
ENCFF004YAN Karpas-422 (Cell line) 1.00 50.00 0.01 100.00
ENCFF015UJX spleen (Tissue) 23.00 62.16 0.13 100.00
ENCFF023EVA A375 (Cell line) 83.00 76.85 0.57 100.00
ENCFF059WHB prostate gland (Tissue) 28.00 62.22 0.10 100.00
ENCFF073SVL transverse colon (Tissue) 509.00 48.71 2.44 100.00
ENCFF076JME ovary (Tissue) 1.00 25.00 0.00 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 10.00 83.33 0.02 100.00
ENCFF192PKY upper lobe of left lung (Tissue) 9.00 90.00 0.05 100.00
ENCFF195CBI testis (Tissue) 127.00 44.88 0.63 100.00
ENCFF211GIU transverse colon (Tissue) 296.00 53.24 1.45 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 141.00 39.83 0.11 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 605.00 68.13 2.73 100.00
ENCFF226BCZ Karpas-422 (Cell line) 5.00 100.00 0.03 100.00
ENCFF261XRS stomach (Tissue) 2.00 50.00 0.01 100.00
ENCFF274FTM prostate gland (Tissue) 11.00 40.74 0.04 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 512.00 63.60 2.45 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 50.00 28.25 0.06 100.00
ENCFF310THB vagina (Tissue) 31.00 37.35 0.13 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 65.00 67.01 0.42 100.00
ENCFF381DXM transverse colon (Tissue) 1779.00 46.63 6.91 100.00
ENCFF400GBK spleen (Tissue) 4.00 44.44 0.02 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 2.00 100.00 0.01 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 44.00 70.97 0.15 100.00
ENCFF476SLG A375 (Cell line) 57.00 80.28 0.47 100.00
ENCFF478BJL testis (Tissue) 10.00 27.78 0.06 100.00
ENCFF495VAK Peyer's patch (Tissue) 354.00 39.69 0.70 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 19.00 52.78 0.18 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 6.00 85.71 0.02 100.00
ENCFF516CUT adrenal gland (Tissue) 49.00 50.00 0.27 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 254.00 64.14 0.21 100.00
ENCFF534JKI spleen (Tissue) 18.00 43.90 0.07 100.00
ENCFF540WGH HT-29 (Cell line) 98.00 55.68 1.18 100.00
ENCFF546NNZ uterus (Tissue) 108.00 42.02 0.54 100.00
ENCFF625OBY sigmoid colon (Tissue) 6.00 66.67 0.04 100.00
ENCFF643IED upper lobe of left lung (Tissue) 10.00 52.63 0.07 100.00
ENCFF645FQS transverse colon (Tissue) 999.00 54.86 5.26 100.00
ENCFF655CDV sigmoid colon (Tissue) 8.00 42.11 0.03 100.00
ENCFF682YQJ spleen (Tissue) 7.00 63.64 0.03 100.00
ENCFF685KEG stomach (Tissue) 9.00 64.29 0.05 100.00
ENCFF686BEE adrenal gland (Tissue) 7.00 70.00 0.05 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 19.00 32.20 0.11 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 72.00 61.54 0.48 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 15.00 48.39 0.14 100.00
ENCFF728EUS sigmoid colon (Tissue) 11.00 44.00 0.07 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 3.00 42.86 0.01 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 3.00 100.00 0.02 100.00
ENCFF800ZUT tibial nerve (Tissue) 113.00 50.67 0.94 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 1.00 100.00 0.00 100.00
ENCFF834CUR HT-29 (Cell line) 84.00 55.26 1.11 100.00
ENCFF853XSN Peyer's patch (Tissue) 1177.00 37.50 3.56 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 669.00 62.58 1.95 100.00
ENCFF908XAD omental fat pad (Tissue) 2.00 40.00 0.00 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 116.00 58.00 0.13 100.00

RNA secondary structure