sncRNA detail

ENST00000581072.6_810_831_+

Derived from ENST00000581072.6 • Homo Sapiens

75 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
MIR133A1HG-202
Gene
MIR133A1HG (ENSG00000265142.9)
Precursor type
lncRNA
Sequence
TGGAATGTAAAGAAGTATGTAT
Start
Start: 810
End
End: 831
Length
Length: 22
Expression (sum)
98150.00
Expression fraction
1.14
Expression (Avg non-zero)
1308.67
Expression (max)
22987.00
Expression (CPM sum)
2.49
Expression (CPM avg non-zero)
3.46
Expression (CPM max)
21.72
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
MIR133A1HG-202
Transcript ID
ENST00000581072.6
Chromosome
chr18
Genomic start
21825487
Genomic end
21831539

Gene context

Gene name
MIR133A1HG
Gene ID
ENSG00000265142.9
Gene type
lncRNA

Expression table

Showing 75 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001RLS parietal lobe (Tissue) 3.00 1.96 0.01 100.00
ENCFF001RLT temporal lobe (Tissue) 25.00 2.38 0.04 100.00
ENCFF001RLU spinal cord (Tissue) 25.00 1.76 0.08 100.00
ENCFF001RLV tongue (Tissue) 14794.00 1.93 40.13 100.00
ENCFF001RLX spinal cord (Tissue) 88.00 2.22 0.16 100.00
ENCFF001RLY diencephalon (Tissue) 5.00 1.79 0.01 100.00
ENCFF001RLZ heart (Tissue) 22987.00 1.56 21.72 100.00
ENCFF001RMA skin of body (Tissue) 28.00 0.77 0.07 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 6182.00 0.72 19.95 100.00
ENCFF001RMC temporal lobe (Tissue) 5.00 1.67 0.01 100.00
ENCFF001RMD uterus (Tissue) 293.00 8.44 0.48 100.00
ENCFF001RME occipital lobe (Tissue) 2.00 2.60 0.00 100.00
ENCFF001RMF metanephros (Tissue) 3.00 0.64 0.01 100.00
ENCFF001RMH lung (Tissue) 62.00 2.45 0.14 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 1925.00 0.40 8.35 100.00
ENCFF001RMJ skin of body (Tissue) 2559.00 1.75 6.65 100.00
ENCFF001RMK heart (Tissue) 10392.00 1.12 18.03 100.00
ENCFF001RML cerebellum (Tissue) 2.00 0.76 0.00 100.00
ENCFF001RMM frontal cortex (Tissue) 17.00 1.84 0.03 100.00
ENCFF001RMN uterus (Tissue) 238.00 3.49 0.45 100.00
ENCFF001RMO cerebellum (Tissue) 3.00 0.47 0.01 100.00
ENCFF001RMP frontal cortex (Tissue) 2.00 1.55 0.00 100.00
ENCFF001RMQ lung (Tissue) 65.00 1.07 0.10 100.00
ENCFF001RMR thyroid gland (Tissue) 508.00 2.94 1.13 100.00
ENCFF001RMS diencephalon (Tissue) 4.00 2.03 0.01 100.00
ENCFF001RMT thyroid gland (Tissue) 17355.00 1.23 22.89 100.00
ENCFF001RMU metanephros (Tissue) 1941.00 1.81 4.07 100.00
ENCFF001RMV tongue (Tissue) 14882.00 0.65 29.01 100.00
ENCFF001RTT urinary bladder (Tissue) 808.00 1.06 2.18 100.00
ENCFF004BLT GM23338 (Cell line) 1.00 1.08 0.00 100.00
ENCFF059WHB prostate gland (Tissue) 205.00 11.45 0.77 100.00
ENCFF073SVL transverse colon (Tissue) 2.00 0.65 0.01 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 52.00 3.46 0.09 100.00
ENCFF106XDA esophagus muscularis mucosa (Tissue) 54.00 2.25 0.24 100.00
ENCFF181JNF gastroesophageal sphincter (Tissue) 1199.00 42.34 4.56 100.00
ENCFF211GIU transverse colon (Tissue) 9.00 0.73 0.04 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 4.00 0.95 0.00 100.00
ENCFF261XRS stomach (Tissue) 88.00 2.69 0.43 100.00
ENCFF274FTM prostate gland (Tissue) 88.00 3.24 0.35 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 1.00 4.00 0.00 100.00
ENCFF310THB vagina (Tissue) 13.00 1.75 0.05 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 11.00 0.39 0.07 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 21.00 1.28 0.06 100.00
ENCFF379KTQ stomach (Tissue) 13.00 0.80 0.06 100.00
ENCFF381DXM transverse colon (Tissue) 4.00 0.22 0.02 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 3.00 0.78 0.01 100.00
ENCFF450POH GM23338 (Cell line) 4.00 7.27 0.03 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 14.00 4.07 0.05 100.00
ENCFF495VAK Peyer's patch (Tissue) 10.00 9.17 0.02 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 1.00 0.32 0.01 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 22.00 4.87 0.09 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 8.00 1.59 0.01 100.00
ENCFF534JKI spleen (Tissue) 8.00 22.22 0.03 100.00
ENCFF546NNZ uterus (Tissue) 11.00 8.80 0.05 100.00
ENCFF583SZV stomach (Tissue) 81.00 3.54 0.35 100.00
ENCFF625OBY sigmoid colon (Tissue) 82.00 1.63 0.48 100.00
ENCFF631JZF sigmoid colon (Tissue) 8.00 1.18 0.04 100.00
ENCFF643IED upper lobe of left lung (Tissue) 1.00 1.19 0.01 100.00
ENCFF645FQS transverse colon (Tissue) 11.00 0.53 0.06 100.00
ENCFF655CDV sigmoid colon (Tissue) 86.00 2.06 0.31 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 31.00 0.72 0.13 100.00
ENCFF682YQJ spleen (Tissue) 5.00 7.94 0.02 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 6.00 4.38 0.03 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 5.00 0.19 0.03 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 2.00 0.54 0.02 100.00
ENCFF728EUS sigmoid colon (Tissue) 26.00 0.62 0.17 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 442.00 15.89 1.35 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 3.00 2.00 0.02 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 31.00 1.51 0.21 100.00
ENCFF800ZUT tibial nerve (Tissue) 1.00 0.89 0.01 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 257.00 6.68 1.09 100.00
ENCFF853XSN Peyer's patch (Tissue) 14.00 5.26 0.04 100.00
ENCFF908XAD omental fat pad (Tissue) 1.00 1.67 0.00 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 1.00 0.29 0.01 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 7.00 6.14 0.01 100.00

RNA secondary structure