sncRNA detail

ENST00000390751.3_47_68_+

Derived from ENST00000390751.3 Homo Sapiens

70 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
MIR543-201
Gene
MIR543 (ENSG00000212040.3)
Precursor type
miRNA
Sequence
AAACATTCGCGGTGCACTTCTT
Start
Start: 47
End
End: 68
Length
Length: 22
Expression (sum)
79974.00
Expression fraction
70.27
Expression (Avg non-zero)
1142.49
Expression (max)
40362.00
Expression (CPM sum)
2.12
Expression (CPM avg non-zero)
2.73
Expression (CPM max)
78.67
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
MIR543-201
Transcript ID
ENST00000390751.3
Chromosome
chr14
Genomic start
101031987
Genomic end
101032064

Gene context

Gene name
MIR543
Gene ID
ENSG00000212040.3
Gene type
miRNA

Expression table

Showing 70 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001RLS parietal lobe (Tissue) 131.00 49.62 0.46 100.00
ENCFF001RLT temporal lobe (Tissue) 244.00 45.95 0.41 100.00
ENCFF001RLU spinal cord (Tissue) 229.00 56.54 0.78 100.00
ENCFF001RLV tongue (Tissue) 9045.00 66.44 24.54 100.00
ENCFF001RLW occipital lobe (Tissue) 19.00 43.18 0.06 100.00
ENCFF001RLX spinal cord (Tissue) 370.00 52.86 0.68 100.00
ENCFF001RLY diencephalon (Tissue) 348.00 53.37 0.99 100.00
ENCFF001RLZ heart (Tissue) 133.00 54.07 0.13 100.00
ENCFF001RMA skin of body (Tissue) 182.00 47.64 0.45 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 11450.00 74.62 36.96 100.00
ENCFF511CAA neuronal stem cell (In vitro differentiated cells) 368.00 56.18 2.84 100.00
ENCFF001RMC temporal lobe (Tissue) 216.00 43.20 0.44 100.00
ENCFF001RMD uterus (Tissue) 291.00 57.40 0.48 100.00
ENCFF001RME occipital lobe (Tissue) 46.00 50.55 0.10 100.00
ENCFF001RMF metanephros (Tissue) 16.00 55.17 0.03 100.00
ENCFF001RMG parietal lobe (Tissue) 36.00 47.37 0.15 100.00
ENCFF001RMH lung (Tissue) 66.00 51.56 0.15 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 8321.00 75.57 36.09 100.00
ENCFF001RMJ skin of body (Tissue) 901.00 59.16 2.34 100.00
ENCFF001RMK heart (Tissue) 59.00 50.43 0.10 100.00
ENCFF001RML cerebellum (Tissue) 156.00 50.81 0.29 100.00
ENCFF001RMM frontal cortex (Tissue) 85.00 42.29 0.14 100.00
ENCFF001RMN uterus (Tissue) 128.00 50.59 0.24 100.00
ENCFF001RMO cerebellum (Tissue) 67.00 52.76 0.13 100.00
ENCFF001RMP frontal cortex (Tissue) 113.00 51.60 0.18 100.00
ENCFF001RMQ lung (Tissue) 55.00 47.01 0.08 100.00
ENCFF001RMR thyroid gland (Tissue) 66.00 48.89 0.15 100.00
ENCFF001RMS diencephalon (Tissue) 312.00 49.45 0.65 100.00
ENCFF001RMT thyroid gland (Tissue) 4437.00 68.95 5.85 100.00
ENCFF001RMU metanephros (Tissue) 554.00 58.19 1.16 100.00
ENCFF001RMV tongue (Tissue) 40362.00 72.95 78.67 100.00
ENCFF001RTT urinary bladder (Tissue) 320.00 54.33 0.86 100.00
ENCFF001RTU liver (Tissue) 352.00 50.50 1.05 100.00
ENCFF015UJX spleen (Tissue) 11.00 45.83 0.06 100.00
ENCFF062TYF GM23248 (Cell line) 3.00 25.00 0.13 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 3.00 60.00 0.01 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 6.00 60.00 0.00 100.00
ENCFF195CBI testis (Tissue) 2.00 100.00 0.01 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 4.00 80.00 0.00 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 1.00 50.00 0.00 100.00
ENCFF261XRS stomach (Tissue) 8.00 61.54 0.04 100.00
ENCFF274FTM prostate gland (Tissue) 2.00 33.33 0.01 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 8.00 53.33 0.01 100.00
ENCFF310THB vagina (Tissue) 1.00 25.00 0.00 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 1.00 50.00 0.01 100.00
ENCFF379KTQ stomach (Tissue) 1.00 50.00 0.00 100.00
ENCFF381DXM transverse colon (Tissue) 3.00 100.00 0.01 100.00
ENCFF478BJL testis (Tissue) 4.00 100.00 0.03 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 6.00 33.33 0.06 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 1.00 50.00 0.00 100.00
ENCFF516CUT adrenal gland (Tissue) 19.00 33.93 0.10 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 2.00 28.57 0.00 100.00
ENCFF534JKI spleen (Tissue) 6.00 75.00 0.02 100.00
ENCFF551ARD thyroid gland (Tissue) 2.00 100.00 0.01 100.00
ENCFF590YKZ GM23248 (Cell line) 8.00 47.06 0.16 100.00
ENCFF625OBY sigmoid colon (Tissue) 4.00 57.14 0.02 100.00
ENCFF645FQS transverse colon (Tissue) 1.00 50.00 0.01 100.00
ENCFF655CDV sigmoid colon (Tissue) 2.00 100.00 0.01 100.00
ENCFF682YQJ spleen (Tissue) 2.00 13.33 0.01 100.00
ENCFF685KEG stomach (Tissue) 6.00 100.00 0.03 100.00
ENCFF686BEE adrenal gland (Tissue) 16.00 47.06 0.11 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 1.00 25.00 0.01 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 8.00 50.00 0.07 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 3.00 100.00 0.01 100.00
ENCFF853XSN Peyer's patch (Tissue) 3.00 100.00 0.01 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 2.00 100.00 0.01 100.00
ENCFF908XAD omental fat pad (Tissue) 3.00 60.00 0.01 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 340.00 55.19 2.48 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 1.00 50.00 0.00 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 2.00 66.67 0.00 100.00

RNA secondary structure