sncRNA detail

ENST00000384857.1_61_83_+

Derived from ENST00000384857.1 • Homo Sapiens

79 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
MIR508-201
Gene
MIR508 (ENSG00000207589.1)
Precursor type
miRNA
Sequence
TGATTGTAGCCTTTTGGAGTAGA
Start
Start: 61
End
End: 83
Length
Length: 23
Expression (sum)
47833.00
Expression fraction
79.40
Expression (Avg non-zero)
605.48
Expression (max)
22986.00
Expression (CPM sum)
1.36
Expression (CPM avg non-zero)
1.48
Expression (CPM max)
144.03
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
MIR508-201
Transcript ID
ENST00000384857.1
Chromosome
chrX
Genomic start
147236913
Genomic end
147237027

Gene context

Gene name
MIR508
Gene ID
ENSG00000207589.1
Gene type
miRNA

Expression table

Showing 79 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 4.00 44.44 0.01 100.00
ENCFF001REL K562 (Cell line) 4.00 66.67 0.01 100.00
ENCFF001REQ K562 (Cell line) 5.00 100.00 0.01 100.00
ENCFF001RER GM12878 (Cell line) 2.00 100.00 0.00 100.00
ENCFF001RLS parietal lobe (Tissue) 50.00 76.92 0.18 100.00
ENCFF001RLT temporal lobe (Tissue) 104.00 64.60 0.17 100.00
ENCFF001RLU spinal cord (Tissue) 34.00 70.83 0.12 100.00
ENCFF001RLV tongue (Tissue) 60.00 56.60 0.16 100.00
ENCFF001RLW occipital lobe (Tissue) 82.00 68.91 0.27 100.00
ENCFF001RLX spinal cord (Tissue) 43.00 58.11 0.08 100.00
ENCFF001RLY diencephalon (Tissue) 28.00 63.64 0.08 100.00
ENCFF001RLZ heart (Tissue) 7.00 38.89 0.01 100.00
ENCFF001RMA skin of body (Tissue) 574.00 72.29 1.41 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 61.00 53.98 0.20 100.00
ENCFF511CAA neuronal stem cell (In vitro differentiated cells) 11.00 73.33 0.09 100.00
ENCFF001RMC temporal lobe (Tissue) 12.00 66.67 0.02 100.00
ENCFF001RMD uterus (Tissue) 695.00 68.74 1.15 100.00
ENCFF001RME occipital lobe (Tissue) 61.00 64.89 0.13 100.00
ENCFF001RMF metanephros (Tissue) 303.00 66.45 0.56 100.00
ENCFF001RMG parietal lobe (Tissue) 27.00 77.14 0.11 100.00
ENCFF001RMH lung (Tissue) 28.00 62.22 0.06 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 38.00 66.67 0.16 100.00
ENCFF001RMJ skin of body (Tissue) 228.00 68.06 0.59 100.00
ENCFF001RMK heart (Tissue) 10.00 66.67 0.02 100.00
ENCFF001RML cerebellum (Tissue) 14.00 66.67 0.03 100.00
ENCFF001RMM frontal cortex (Tissue) 13.00 56.52 0.02 100.00
ENCFF001RMN uterus (Tissue) 79.00 67.52 0.15 100.00
ENCFF001RMO cerebellum (Tissue) 9.00 90.00 0.02 100.00
ENCFF001RMP frontal cortex (Tissue) 10.00 66.67 0.02 100.00
ENCFF001RMQ lung (Tissue) 20.00 66.67 0.03 100.00
ENCFF001RMR thyroid gland (Tissue) 345.00 56.10 0.77 100.00
ENCFF001RMS diencephalon (Tissue) 82.00 63.57 0.17 100.00
ENCFF001RMT thyroid gland (Tissue) 33.00 56.90 0.04 100.00
ENCFF001RMU metanephros (Tissue) 908.00 71.27 1.90 100.00
ENCFF001RMV tongue (Tissue) 59.00 49.58 0.11 100.00
ENCFF001RTT urinary bladder (Tissue) 26.00 70.27 0.07 100.00
ENCFF001RTU liver (Tissue) 1.00 25.00 0.00 100.00
ENCFF004BLT GM23338 (Cell line) 2.00 100.00 0.00 100.00
ENCFF004YAN Karpas-422 (Cell line) 1.00 100.00 0.01 100.00
ENCFF059WHB prostate gland (Tissue) 1.00 100.00 0.00 100.00
ENCFF076JME ovary (Tissue) 2143.00 77.70 9.43 100.00
ENCFF106XDA esophagus muscularis mucosa (Tissue) 2.00 50.00 0.01 100.00
ENCFF181JNF gastroesophageal sphincter (Tissue) 3.00 100.00 0.01 100.00
ENCFF192PKY upper lobe of left lung (Tissue) 28.00 90.32 0.17 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 1.00 100.00 0.00 100.00
ENCFF195CBI testis (Tissue) 15468.00 79.70 77.05 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 53.00 80.30 0.04 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 1.00 100.00 0.00 100.00
ENCFF274FTM prostate gland (Tissue) 20.00 58.82 0.08 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 1.00 50.00 0.00 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 45.00 93.75 0.05 100.00
ENCFF310THB vagina (Tissue) 3.00 60.00 0.01 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 119.00 74.38 0.76 100.00
ENCFF379KTQ stomach (Tissue) 5.00 100.00 0.02 100.00
ENCFF450POH GM23338 (Cell line) 14.00 93.33 0.11 100.00
ENCFF476SLG A375 (Cell line) 1.00 100.00 0.01 100.00
ENCFF478BJL testis (Tissue) 22986.00 82.73 144.03 100.00
ENCFF495VAK Peyer's patch (Tissue) 5.00 100.00 0.01 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 31.00 70.45 0.29 100.00
ENCFF516CUT adrenal gland (Tissue) 1365.00 73.15 7.50 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 296.00 77.69 0.25 100.00
ENCFF534JKI spleen (Tissue) 1.00 100.00 0.00 100.00
ENCFF546NNZ uterus (Tissue) 2.00 100.00 0.01 100.00
ENCFF551ARD thyroid gland (Tissue) 4.00 80.00 0.03 100.00
ENCFF583SZV stomach (Tissue) 11.00 100.00 0.05 100.00
ENCFF643IED upper lobe of left lung (Tissue) 41.00 85.42 0.30 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 2.00 100.00 0.01 100.00
ENCFF682YQJ spleen (Tissue) 3.00 100.00 0.01 100.00
ENCFF686BEE adrenal gland (Tissue) 643.00 76.37 4.34 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 129.00 88.97 0.73 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 118.00 74.21 0.78 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 34.00 69.39 0.31 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 2.00 100.00 0.01 100.00
ENCFF800ZUT tibial nerve (Tissue) 3.00 100.00 0.02 100.00
ENCFF853XSN Peyer's patch (Tissue) 28.00 73.68 0.08 100.00
ENCFF908XAD omental fat pad (Tissue) 2.00 100.00 0.00 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 13.00 86.67 0.09 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 131.00 74.86 0.15 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 2.00 100.00 0.00 100.00

RNA secondary structure