sncRNA detail

ENST00000778783.1_84_171_+

Derived from ENST00000778783.1 • Homo Sapiens

68 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
ENST00000778783
Gene
ENSG00000290790 (ENSG00000290790.2)
Precursor type
lncRNA
Sequence
ATGTCTCTGTGGCGCAATCGGCTAGCGCGTTTGGCTGTTAACTAAAAGGTTGGTGGTTCGAACCCACCCAGAGGCGTCGCTGGTCTTT
Start
Start: 84
End
End: 171
Length
Length: 88
Expression (sum)
62740.00
Expression fraction
38.63
Expression (Avg non-zero)
922.65
Expression (max)
13440.00
Expression (CPM sum)
1.66
Expression (CPM avg non-zero)
2.11
Expression (CPM max)
11.08
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
ENST00000778783
Transcript ID
ENST00000778783.1
Chromosome
chr1
Genomic start
149719894
Genomic end
149740406

Gene context

Gene name
ENSG00000290790
Gene ID
ENSG00000290790.2
Gene type
lncRNA

Expression table

Showing 68 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 1.00 0.06 0.04 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 1.00 0.80 0.06 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 2.00 0.25 0.05 100.00
ENCFF001REE GM12878 (Cell line) 2718.00 22.00 7.01 100.00
ENCFF001REL K562 (Cell line) 397.00 34.95 0.74 100.00
ENCFF001REQ K562 (Cell line) 298.00 17.98 0.76 100.00
ENCFF001RER GM12878 (Cell line) 8056.00 51.23 16.64 100.00
ENCFF001RLS parietal lobe (Tissue) 350.00 70.56 1.24 100.00
ENCFF001RLT temporal lobe (Tissue) 2556.00 73.09 4.24 100.00
ENCFF001RLU spinal cord (Tissue) 563.00 63.98 1.91 100.00
ENCFF001RLV tongue (Tissue) 75.00 14.76 0.20 100.00
ENCFF001RLW occipital lobe (Tissue) 511.00 76.96 1.66 100.00
ENCFF001RLX spinal cord (Tissue) 358.00 46.37 0.66 100.00
ENCFF001RLY diencephalon (Tissue) 4180.00 76.94 11.93 100.00
ENCFF001RLZ heart (Tissue) 328.00 76.81 0.31 100.00
ENCFF001RMA skin of body (Tissue) 575.00 66.32 1.42 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 141.00 42.73 0.46 100.00
ENCFF001RMC temporal lobe (Tissue) 114.00 39.45 0.23 100.00
ENCFF001RMD uterus (Tissue) 590.00 70.49 0.98 100.00
ENCFF001RME occipital lobe (Tissue) 1915.00 80.53 4.05 100.00
ENCFF001RMF metanephros (Tissue) 1193.00 80.94 2.22 100.00
ENCFF001RMG parietal lobe (Tissue) 373.00 70.64 1.59 100.00
ENCFF001RMH lung (Tissue) 380.00 72.24 0.86 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 90.00 53.89 0.39 100.00
ENCFF001RMJ skin of body (Tissue) 252.00 52.17 0.66 100.00
ENCFF001RMK heart (Tissue) 230.00 70.12 0.40 100.00
ENCFF001RML cerebellum (Tissue) 2730.00 78.56 5.05 100.00
ENCFF001RMM frontal cortex (Tissue) 1163.00 80.65 1.92 100.00
ENCFF001RMN uterus (Tissue) 778.00 60.83 1.49 100.00
ENCFF001RMO cerebellum (Tissue) 160.00 55.17 0.31 100.00
ENCFF001RMP frontal cortex (Tissue) 2523.00 80.56 4.03 100.00
ENCFF001RMQ lung (Tissue) 882.00 73.93 1.33 100.00
ENCFF001RMR thyroid gland (Tissue) 22.00 20.18 0.05 100.00
ENCFF001RMS diencephalon (Tissue) 2435.00 73.77 5.05 100.00
ENCFF001RMT thyroid gland (Tissue) 274.00 34.99 0.36 100.00
ENCFF001RMU metanephros (Tissue) 132.00 73.74 0.28 100.00
ENCFF001RMV tongue (Tissue) 452.00 56.22 0.88 100.00
ENCFF001RTT urinary bladder (Tissue) 665.00 73.97 1.79 100.00
ENCFF001RTU liver (Tissue) 736.00 63.94 2.19 100.00
ENCFF004BLT GM23338 (Cell line) 5581.00 21.60 6.70 100.00
ENCFF023EVA A375 (Cell line) 27.00 71.05 0.19 100.00
ENCFF073SVL transverse colon (Tissue) 1.00 1.89 0.00 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 278.00 37.07 0.51 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 13440.00 87.57 11.08 100.00
ENCFF211GIU transverse colon (Tissue) 1.00 1.19 0.00 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 134.00 31.09 0.10 100.00
ENCFF274FTM prostate gland (Tissue) 2.00 3.45 0.01 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 395.00 51.91 0.46 100.00
ENCFF299ETH OCI-LY7 (Cell line) 1.00 14.29 0.01 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 48.00 36.09 0.14 100.00
ENCFF381DXM transverse colon (Tissue) 10.00 7.41 0.04 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 37.00 12.80 0.18 100.00
ENCFF450POH GM23338 (Cell line) 255.00 0.95 1.97 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 592.00 24.16 1.95 100.00
ENCFF476SLG A375 (Cell line) 6.00 50.00 0.05 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 18.00 0.77 0.07 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 287.00 49.91 0.24 100.00
ENCFF521RDG OCI-LY7 (Cell line) 1.00 50.00 0.01 100.00
ENCFF540WGH HT-29 (Cell line) 11.00 78.57 0.13 100.00
ENCFF645FQS transverse colon (Tissue) 5.00 12.50 0.03 100.00
ENCFF686BEE adrenal gland (Tissue) 7.00 2.25 0.05 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 25.00 2.16 0.23 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 12.00 30.00 0.08 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 15.00 48.39 0.06 100.00
ENCFF834CUR HT-29 (Cell line) 9.00 81.82 0.12 100.00
ENCFF908XAD omental fat pad (Tissue) 39.00 15.98 0.09 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 455.00 64.08 0.51 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 1849.00 74.20 1.12 100.00

RNA secondary structure