sncRNA detail

ENST00000762395.1_397_430_+

Derived from ENST00000762395.1 • Homo Sapiens

69 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
LINC02806-241
Gene
LINC02806 (ENSG00000238107.2)
Precursor type
lncRNA
Sequence
ATGTCGTTAGTCTAGGCTGTCAGCTCTTCCCTTT
Start
Start: 397
End
End: 430
Length
Length: 34
Expression (sum)
46774.00
Expression fraction
0.34
Expression (Avg non-zero)
677.88
Expression (max)
10844.00
Expression (CPM sum)
1.18
Expression (CPM avg non-zero)
1.78
Expression (CPM max)
102.82
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
LINC02806-241
Transcript ID
ENST00000762395.1
Chromosome
chr1
Genomic start
148281041
Genomic end
148289573

Gene context

Gene name
LINC02806
Gene ID
ENSG00000238107.2
Gene type
lncRNA

Expression table

Showing 69 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 197.00 0.15 0.51 100.00
ENCFF001REL K562 (Cell line) 1016.00 1.91 1.89 100.00
ENCFF001REQ K562 (Cell line) 569.00 0.74 1.44 100.00
ENCFF001RER GM12878 (Cell line) 314.00 0.38 0.65 100.00
ENCFF001RLT temporal lobe (Tissue) 5.00 0.02 0.01 100.00
ENCFF001RLW occipital lobe (Tissue) 1.00 0.03 0.00 100.00
ENCFF001RLY diencephalon (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RLZ heart (Tissue) 5.00 0.04 0.00 100.00
ENCFF001RMA skin of body (Tissue) 168.00 0.30 0.41 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 16.00 0.04 0.05 100.00
ENCFF511CAA neuronal stem cell (In vitro differentiated cells) 1139.00 4.69 8.80 100.00
ENCFF001RMD uterus (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 2.00 0.02 0.01 100.00
ENCFF001RMJ skin of body (Tissue) 4.00 0.00 0.01 100.00
ENCFF001RMM frontal cortex (Tissue) 2.00 0.02 0.00 100.00
ENCFF001RMO cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMP frontal cortex (Tissue) 2.00 0.02 0.00 100.00
ENCFF001RMS diencephalon (Tissue) 1.00 0.01 0.00 100.00
ENCFF001RMT thyroid gland (Tissue) 91.00 0.24 0.12 100.00
ENCFF001RMV tongue (Tissue) 4.00 0.02 0.01 100.00
ENCFF001RTU liver (Tissue) 1.00 0.01 0.00 100.00
ENCFF004BLT GM23338 (Cell line) 115.00 0.01 0.14 100.00
ENCFF004YAN Karpas-422 (Cell line) 1.00 0.00 0.01 100.00
ENCFF015UJX spleen (Tissue) 3.00 0.01 0.02 100.00
ENCFF062TYF GM23248 (Cell line) 12.00 0.62 0.51 100.00
ENCFF076JME ovary (Tissue) 5.00 0.01 0.02 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 28.00 0.30 0.05 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 101.00 0.31 0.08 100.00
ENCFF211GIU transverse colon (Tissue) 1.00 0.00 0.00 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 151.00 0.05 0.11 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 2170.00 3.40 9.80 100.00
ENCFF226BCZ Karpas-422 (Cell line) 3.00 0.01 0.02 100.00
ENCFF261XRS stomach (Tissue) 49.00 0.02 0.24 100.00
ENCFF274FTM prostate gland (Tissue) 1.00 0.00 0.00 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 3373.00 4.42 16.14 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 102.00 0.08 0.12 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 7839.00 9.10 50.32 100.00
ENCFF338AVU gastroesophageal sphincter (Tissue) 10.00 0.03 0.03 100.00
ENCFF379KTQ stomach (Tissue) 16.00 0.00 0.07 100.00
ENCFF381DXM transverse colon (Tissue) 14.00 0.00 0.05 100.00
ENCFF400GBK spleen (Tissue) 13.00 0.02 0.06 100.00
ENCFF450POH GM23338 (Cell line) 132.00 0.02 1.02 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 28.00 0.13 0.09 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 10844.00 8.61 102.82 100.00
ENCFF516CUT adrenal gland (Tissue) 9.00 0.01 0.05 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 41.00 0.05 0.03 100.00
ENCFF521RDG OCI-LY7 (Cell line) 1.00 0.02 0.01 100.00
ENCFF534JKI spleen (Tissue) 2.00 0.00 0.01 100.00
ENCFF590YKZ GM23248 (Cell line) 18.00 0.79 0.35 100.00
ENCFF625OBY sigmoid colon (Tissue) 1.00 0.01 0.01 100.00
ENCFF643IED upper lobe of left lung (Tissue) 59.00 0.10 0.44 100.00
ENCFF645FQS transverse colon (Tissue) 9.00 0.00 0.05 100.00
ENCFF655CDV sigmoid colon (Tissue) 43.00 0.20 0.16 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 17.00 0.12 0.07 100.00
ENCFF685KEG stomach (Tissue) 9.00 0.02 0.05 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 1.00 0.00 0.01 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 7520.00 9.66 49.81 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 8937.00 6.53 82.09 100.00
ENCFF728EUS sigmoid colon (Tissue) 13.00 0.05 0.08 100.00
ENCFF744HOK gastroesophageal sphincter (Tissue) 3.00 0.02 0.01 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 66.00 0.08 0.48 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 28.00 0.17 0.19 100.00
ENCFF800ZUT tibial nerve (Tissue) 5.00 0.02 0.04 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 3.00 0.01 0.01 100.00
ENCFF853XSN Peyer's patch (Tissue) 1.00 0.00 0.00 100.00
ENCFF908XAD omental fat pad (Tissue) 37.00 0.00 0.09 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 1317.00 4.28 9.59 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 26.00 0.07 0.03 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 57.00 0.18 0.03 100.00

RNA secondary structure