sncRNA detail

ENST00000496055.5_465_553_+

Derived from ENST00000496055.5 • Homo Sapiens

64 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RABGGTB-213
Gene
RABGGTB (ENSG00000137955.16)
Precursor type
protein coding CDS not defined
Sequence
TTTCAAGGTCAATGATGTGTTGGCATGTATTATCTGAATCTATTGCTGATGTGTAATAACACTTTAGCTCTAGAATTACTCTGAGACCT
Start
Start: 465
End
End: 553
Length
Length: 89
Expression (sum)
138879.00
Expression fraction
0.86
Expression (Avg non-zero)
2169.98
Expression (max)
8945.00
Expression (CPM sum)
3.55
Expression (CPM avg non-zero)
10.13
Expression (CPM max)
438.85
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RABGGTB-213
Transcript ID
ENST00000496055.5
Chromosome
chr1
Genomic start
75786197
Genomic end
75794833

Gene context

Gene name
RABGGTB
Gene ID
ENSG00000137955.16
Gene type
protein_coding

Expression table

Showing 64 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 3671.00 54.77 376.12 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 736.00 31.45 61.58 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 623.00 24.37 38.47 100.00
ENCFF000JEH fibroblast of the aortic adventitia (Primary cell) 2519.00 39.43 173.00 100.00
ENCFF000JEI fibroblast of the aortic adventitia (Primary cell) 4337.00 44.25 229.21 100.00
ENCFF000JEU thoracic aorta endothelial cell (Primary cell) 2343.00 51.08 179.53 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 2619.00 48.16 235.45 100.00
ENCFF000JFN articular chondrocyte of knee joint (Primary cell) 1794.00 31.05 153.88 100.00
ENCFF000JGN articular chondrocyte of knee joint (Primary cell) 1536.00 35.83 144.56 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 1732.00 44.91 183.57 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 3308.00 41.62 175.75 100.00
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 2860.00 33.41 117.32 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 398.00 43.21 132.58 100.00
ENCFF000JJV mesenchymal stem cell of adipose (Primary cell) 2677.00 34.20 87.73 100.00
ENCFF000JKK mesenchymal stem cell of Wharton's jelly (Primary cell) 2785.00 38.86 167.03 100.00
ENCFF000JKT mesenchymal stem cell of Wharton's jelly (Primary cell) 5476.00 41.71 278.05 100.00
ENCFF000JKU osteoblast (Primary cell) 547.00 37.59 176.74 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 2313.00 39.13 142.74 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 3334.00 51.91 118.76 100.00
ENCFF000JLG osteoblast (Primary cell) 2832.00 37.25 271.50 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 3593.00 40.67 80.86 100.00
ENCFF000JLU placental pericyte (Primary cell) 1760.00 38.85 215.54 100.00
ENCFF000JLV placental pericyte (Primary cell) 8076.00 47.93 170.61 100.00
ENCFF000JMQ placental epithelial cell (Primary cell) 5006.00 31.08 216.76 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 7978.00 36.54 175.84 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 6844.00 46.62 200.91 100.00
ENCFF000JNK vein endothelial cell (Primary cell) 8188.00 51.01 232.43 100.00
ENCFF000JNS fibroblast of villous mesenchyme (Primary cell) 1798.00 53.01 354.75 100.00
ENCFF000JOD fibroblast of villous mesenchyme (Primary cell) 2239.00 47.99 345.94 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 5995.00 51.42 156.22 100.00
ENCFF000JOR subcutaneous preadipocyte (Primary cell) 4845.00 42.72 82.25 100.00
ENCFF000JQC IMR-90 (Cell line) 34.00 22.08 58.31 100.00
ENCFF000JQE IMR-90 (Cell line) 140.00 71.07 150.00 100.00
ENCFF000KCE fibroblast of dermis (Primary cell) 4031.00 51.30 280.44 100.00
ENCFF000KCV fibroblast of dermis (Primary cell) 4114.00 49.58 525.36 100.00
ENCFF000KEC melanocyte of skin (Primary cell) 4529.00 40.09 400.82 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 3728.00 51.31 325.39 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 8945.00 49.76 438.85 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 3946.00 47.07 257.07 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 2791.00 49.87 300.26 100.00
ENCFF000KHC SK-N-SH (Cell line) 1572.00 54.23 527.55 100.00
ENCFF000KIC SK-N-SH (Cell line) 238.00 47.13 63.42 100.00
ENCFF001REL K562 (Cell line) 2.00 0.00 0.00 100.00
ENCFF001REQ K562 (Cell line) 2.00 0.00 0.01 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMC temporal lobe (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMD uterus (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMF metanephros (Tissue) 2.00 0.00 0.00 100.00
ENCFF001RMJ skin of body (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMK heart (Tissue) 2.00 0.00 0.00 100.00
ENCFF001RML cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMN uterus (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMO cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RTU liver (Tissue) 1.00 0.00 0.00 100.00
ENCFF004YAN Karpas-422 (Cell line) 3.00 0.00 0.02 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 4.00 0.00 0.00 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 9.00 0.00 0.01 100.00
ENCFF226BCZ Karpas-422 (Cell line) 3.00 0.00 0.02 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 3.00 0.00 0.00 100.00
ENCFF299ETH OCI-LY7 (Cell line) 3.00 0.00 0.03 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 4.00 0.00 0.00 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 2.00 0.00 0.01 100.00
ENCFF908XAD omental fat pad (Tissue) 1.00 0.00 0.00 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 1.00 0.00 0.00 100.00

RNA secondary structure