sncRNA detail

ENST00000615835.1_56_79_+

Derived from ENST00000615835.1 Homo Sapiens

82 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
MIR7974-201
Gene
MIR7974 (ENSG00000274713.1)
Precursor type
miRNA
Sequence
AGGCTGTGATGCTCTCCTGAGCCC
Start
Start: 56
End
End: 79
Length
Length: 24
Expression (sum)
70397.00
Expression fraction
94.43
Expression (Avg non-zero)
858.50
Expression (max)
14809.00
Expression (CPM sum)
1.97
Expression (CPM avg non-zero)
2.32
Expression (CPM max)
38.19
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
MIR7974-201
Transcript ID
ENST00000615835.1
Chromosome
chr19
Genomic start
11495544
Genomic end
11495622

Gene context

Gene name
MIR7974
Gene ID
ENSG00000274713.1
Gene type
miRNA

Expression table

Showing 82 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 14809.00 92.60 38.19 100.00
ENCFF001REL K562 (Cell line) 3487.00 94.04 6.48 100.00
ENCFF001REQ K562 (Cell line) 6298.00 94.11 15.98 100.00
ENCFF001RER GM12878 (Cell line) 9791.00 93.63 20.22 100.00
ENCFF001RLT temporal lobe (Tissue) 5.00 100.00 0.01 100.00
ENCFF001RLU spinal cord (Tissue) 3.00 100.00 0.01 100.00
ENCFF001RLW occipital lobe (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RLY diencephalon (Tissue) 2.00 50.00 0.01 100.00
ENCFF001RLZ heart (Tissue) 24.00 96.00 0.02 100.00
ENCFF001RMA skin of body (Tissue) 4.00 100.00 0.01 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 7.00 100.00 0.02 100.00
ENCFF511CAA neuronal stem cell (In vitro differentiated cells) 2340.00 95.63 18.08 100.00
ENCFF001RMC temporal lobe (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RMD uterus (Tissue) 3.00 100.00 0.00 100.00
ENCFF001RMF metanephros (Tissue) 9.00 100.00 0.02 100.00
ENCFF001RMG parietal lobe (Tissue) 2.00 100.00 0.01 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 7.00 87.50 0.03 100.00
ENCFF001RMK heart (Tissue) 2.00 100.00 0.00 100.00
ENCFF001RML cerebellum (Tissue) 34.00 87.18 0.06 100.00
ENCFF001RMM frontal cortex (Tissue) 4.00 80.00 0.01 100.00
ENCFF001RMN uterus (Tissue) 5.00 83.33 0.01 100.00
ENCFF001RMO cerebellum (Tissue) 4.00 66.67 0.01 100.00
ENCFF001RMP frontal cortex (Tissue) 4.00 100.00 0.01 100.00
ENCFF001RMQ lung (Tissue) 3.00 100.00 0.00 100.00
ENCFF001RMS diencephalon (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RMT thyroid gland (Tissue) 8.00 88.89 0.01 100.00
ENCFF001RMU metanephros (Tissue) 1.00 100.00 0.00 100.00
ENCFF001RMV tongue (Tissue) 13.00 100.00 0.03 100.00
ENCFF001RTT urinary bladder (Tissue) 2.00 66.67 0.01 100.00
ENCFF001RTU liver (Tissue) 75.00 89.29 0.22 100.00
ENCFF004BLT GM23338 (Cell line) 393.00 97.52 0.47 100.00
ENCFF004YAN Karpas-422 (Cell line) 87.00 87.88 0.61 100.00
ENCFF015UJX spleen (Tissue) 8.00 100.00 0.05 100.00
ENCFF023EVA A375 (Cell line) 40.00 95.24 0.28 100.00
ENCFF059WHB prostate gland (Tissue) 6.00 85.71 0.02 100.00
ENCFF062TYF GM23248 (Cell line) 3.00 100.00 0.13 100.00
ENCFF076JME ovary (Tissue) 1.00 100.00 0.00 100.00
ENCFF081QYT esophagus squamous epithelium (Tissue) 3.00 100.00 0.01 100.00
ENCFF158HXL right lobe of liver (Tissue) 4.00 33.33 0.03 100.00
ENCFF192PKY upper lobe of left lung (Tissue) 4.00 100.00 0.02 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 132.00 94.96 0.11 100.00
ENCFF195CBI testis (Tissue) 6.00 100.00 0.03 100.00
ENCFF211GIU transverse colon (Tissue) 15.00 83.33 0.07 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 25.00 96.15 0.02 100.00
ENCFF225QQQ mesenchymal stem cell (In vitro differentiated cells) 274.00 94.48 1.24 100.00
ENCFF226BCZ Karpas-422 (Cell line) 83.00 93.26 0.55 100.00
ENCFF261XRS stomach (Tissue) 9.00 75.00 0.04 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 590.00 96.56 2.82 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 19.00 100.00 0.02 100.00
ENCFF299ETH OCI-LY7 (Cell line) 10.00 90.91 0.10 100.00
ENCFF310THB vagina (Tissue) 3.00 100.00 0.01 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 3637.00 96.50 23.35 100.00
ENCFF379KTQ stomach (Tissue) 11.00 100.00 0.05 100.00
ENCFF381DXM transverse colon (Tissue) 30.00 100.00 0.12 100.00
ENCFF400GBK spleen (Tissue) 5.00 83.33 0.02 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 28.00 87.50 0.14 100.00
ENCFF450POH GM23338 (Cell line) 256.00 95.17 1.98 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 74.00 93.67 0.24 100.00
ENCFF476SLG A375 (Cell line) 21.00 91.30 0.17 100.00
ENCFF478BJL testis (Tissue) 5.00 100.00 0.03 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 10385.00 95.63 98.46 100.00
ENCFF510IHL esophagus squamous epithelium (Tissue) 3.00 100.00 0.01 100.00
ENCFF516CUT adrenal gland (Tissue) 2.00 100.00 0.01 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 21.00 100.00 0.02 100.00
ENCFF521RDG OCI-LY7 (Cell line) 10.00 83.33 0.10 100.00
ENCFF540WGH HT-29 (Cell line) 37.00 90.24 0.44 100.00
ENCFF574WUG right lobe of liver (Tissue) 21.00 80.77 0.18 100.00
ENCFF643IED upper lobe of left lung (Tissue) 8.00 100.00 0.06 100.00
ENCFF645FQS transverse colon (Tissue) 8.00 100.00 0.04 100.00
ENCFF682YQJ spleen (Tissue) 12.00 92.31 0.06 100.00
ENCFF686BEE adrenal gland (Tissue) 1.00 100.00 0.01 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 3.00 37.50 0.02 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 3588.00 95.94 23.77 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 11305.00 95.44 103.84 100.00
ENCFF728EUS sigmoid colon (Tissue) 6.00 100.00 0.04 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 7.00 77.78 0.05 100.00
ENCFF834CUR HT-29 (Cell line) 61.00 98.39 0.80 100.00
ENCFF853XSN Peyer's patch (Tissue) 18.00 90.00 0.05 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 2029.00 95.30 14.78 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 10.00 90.91 0.01 100.00
ENCFF993BFO body of pancreas (Tissue) 14.00 100.00 0.14 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 117.00 90.00 0.07 100.00

RNA secondary structure