sncRNA detail

ENST00000580533.1_1_91_+

Derived from ENST00000580533.1 • Homo Sapiens

70 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
SNORD3C-201
Gene
SNORD3C (ENSG00000264940.5)
Precursor type
snoRNA
Sequence
AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAGGAAGAGAGG
Start
Start: 1
End
End: 91
Length
Length: 91
Expression (sum)
50197.00
Expression fraction
3.27
Expression (Avg non-zero)
717.10
Expression (max)
12353.00
Expression (CPM sum)
1.27
Expression (CPM avg non-zero)
1.80
Expression (CPM max)
36.82
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
SNORD3C-201
Transcript ID
ENST00000580533.1
Chromosome
chr17
Genomic start
19189665
Genomic end
19190245

Gene context

Gene name
SNORD3C
Gene ID
ENSG00000264940.5
Gene type
snoRNA

Expression table

Showing 70 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 7.00 4.02 0.72 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 36.00 1.30 3.01 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 7.00 0.62 0.63 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 12.00 0.40 0.64 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 1.00 0.06 0.04 100.00
ENCFF000JLU placental pericyte (Primary cell) 1.00 0.01 0.12 100.00
ENCFF000JLV placental pericyte (Primary cell) 5.00 0.65 0.11 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 2.00 0.16 0.05 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 1.00 0.15 0.09 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 5.00 0.37 0.25 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 16.00 1.29 1.04 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 2.00 0.44 0.22 100.00
ENCFF001REE GM12878 (Cell line) 278.00 1.60 0.72 100.00
ENCFF001REL K562 (Cell line) 899.00 2.25 1.67 100.00
ENCFF001REQ K562 (Cell line) 1416.00 4.52 3.59 100.00
ENCFF001RER GM12878 (Cell line) 758.00 3.58 1.57 100.00
ENCFF001RLS parietal lobe (Tissue) 692.00 5.34 2.45 100.00
ENCFF001RLT temporal lobe (Tissue) 245.00 0.61 0.41 100.00
ENCFF001RLU spinal cord (Tissue) 251.00 1.54 0.85 100.00
ENCFF001RLV tongue (Tissue) 103.00 0.89 0.28 100.00
ENCFF001RLW occipital lobe (Tissue) 1004.00 11.36 3.25 100.00
ENCFF001RLX spinal cord (Tissue) 649.00 1.82 1.19 100.00
ENCFF001RLY diencephalon (Tissue) 727.00 4.99 2.07 100.00
ENCFF001RLZ heart (Tissue) 1590.00 9.75 1.50 100.00
ENCFF001RMA skin of body (Tissue) 452.00 2.19 1.11 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 235.00 2.51 0.76 100.00
ENCFF001RMC temporal lobe (Tissue) 453.00 1.81 0.93 100.00
ENCFF001RMD uterus (Tissue) 289.00 0.63 0.48 100.00
ENCFF001RME occipital lobe (Tissue) 1340.00 10.75 2.84 100.00
ENCFF001RMF metanephros (Tissue) 722.00 3.03 1.34 100.00
ENCFF001RMG parietal lobe (Tissue) 375.00 5.05 1.59 100.00
ENCFF001RMH lung (Tissue) 1982.00 17.01 4.49 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 258.00 3.00 1.12 100.00
ENCFF001RMJ skin of body (Tissue) 321.00 1.86 0.83 100.00
ENCFF001RMK heart (Tissue) 865.00 8.42 1.50 100.00
ENCFF001RML cerebellum (Tissue) 2349.00 8.93 4.34 100.00
ENCFF001RMM frontal cortex (Tissue) 769.00 6.52 1.27 100.00
ENCFF001RMN uterus (Tissue) 503.00 2.05 0.96 100.00
ENCFF001RMO cerebellum (Tissue) 827.00 6.67 1.60 100.00
ENCFF001RMP frontal cortex (Tissue) 605.00 2.79 0.97 100.00
ENCFF001RMQ lung (Tissue) 1187.00 4.76 1.79 100.00
ENCFF001RMR thyroid gland (Tissue) 148.00 0.75 0.33 100.00
ENCFF001RMS diencephalon (Tissue) 1538.00 10.69 3.19 100.00
ENCFF001RMT thyroid gland (Tissue) 287.00 1.74 0.38 100.00
ENCFF001RMU metanephros (Tissue) 939.00 9.04 1.97 100.00
ENCFF001RMV tongue (Tissue) 170.00 0.67 0.33 100.00
ENCFF001RTT urinary bladder (Tissue) 354.00 3.51 0.95 100.00
ENCFF001RTU liver (Tissue) 12353.00 32.90 36.82 100.00
ENCFF004BLT GM23338 (Cell line) 2849.00 6.52 3.42 100.00
ENCFF004YAN Karpas-422 (Cell line) 1395.00 2.49 9.72 100.00
ENCFF023EVA A375 (Cell line) 705.00 6.78 4.85 100.00
ENCFF076JME ovary (Tissue) 5.00 0.16 0.02 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 1797.00 6.07 1.48 100.00
ENCFF211GIU transverse colon (Tissue) 4.00 0.06 0.02 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 80.00 0.16 0.06 100.00
ENCFF226BCZ Karpas-422 (Cell line) 594.00 1.20 3.92 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 357.00 1.01 0.42 100.00
ENCFF299ETH OCI-LY7 (Cell line) 403.00 3.46 4.18 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 3.00 0.03 0.01 100.00
ENCFF450POH GM23338 (Cell line) 587.00 2.71 4.54 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 2.00 0.03 0.01 100.00
ENCFF476SLG A375 (Cell line) 487.00 7.12 3.97 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 219.00 1.25 0.18 100.00
ENCFF521RDG OCI-LY7 (Cell line) 464.00 3.91 4.71 100.00
ENCFF540WGH HT-29 (Cell line) 244.00 8.29 2.93 100.00
ENCFF645FQS transverse colon (Tissue) 2.00 0.04 0.01 100.00
ENCFF834CUR HT-29 (Cell line) 398.00 8.88 5.25 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 1.00 0.02 0.00 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 1359.00 7.34 1.52 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 214.00 0.55 0.13 100.00

RNA secondary structure