sncRNA detail

ENST00000363286.1_1_86_+

Derived from ENST00000363286.1 • Homo Sapiens

67 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RNU5B-1-201
Gene
RNU5B-1 (ENSG00000200156.1)
Precursor type
snRNA
Sequence
ATACTCTGGTTTCTCTTCAGATCGTATAAATCTTTCGCCTTTTACTAAAGATTTCCGTGGAGAGGAACAACTCTGAGTCTTAAGCT
Start
Start: 1
End
End: 86
Length
Length: 86
Expression (sum)
162128.00
Expression fraction
8.65
Expression (Avg non-zero)
2419.82
Expression (max)
11701.00
Expression (CPM sum)
4.11
Expression (CPM avg non-zero)
5.88
Expression (CPM max)
21.64
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RNU5B-1-201
Transcript ID
ENST00000363286.1
Chromosome
chr15
Genomic start
65304677
Genomic end
65304792

Gene context

Gene name
RNU5B-1
Gene ID
ENSG00000200156.1
Gene type
snRNA

Expression table

Showing 67 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000JEC neural cell (In vitro differentiated cells) 3.00 0.14 0.25 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 7.00 0.28 0.43 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 1.00 0.31 0.11 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 1.00 0.68 0.33 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 1.00 0.06 0.04 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 3.00 0.10 0.07 100.00
ENCFF000JLU placental pericyte (Primary cell) 2.00 0.28 0.24 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 1.00 0.24 0.02 100.00
ENCFF001REE GM12878 (Cell line) 59.00 1.64 0.15 100.00
ENCFF001REL K562 (Cell line) 228.00 2.63 0.42 100.00
ENCFF001REQ K562 (Cell line) 3021.00 19.09 7.67 100.00
ENCFF001RER GM12878 (Cell line) 249.00 3.64 0.51 100.00
ENCFF001RLS parietal lobe (Tissue) 10146.00 15.29 35.89 100.00
ENCFF001RLT temporal lobe (Tissue) 7439.00 7.94 12.35 100.00
ENCFF001RLU spinal cord (Tissue) 1053.00 3.84 3.58 100.00
ENCFF001RLV tongue (Tissue) 1094.00 3.54 2.97 100.00
ENCFF001RLW occipital lobe (Tissue) 4510.00 24.98 14.62 100.00
ENCFF001RLX spinal cord (Tissue) 2710.00 4.58 4.97 100.00
ENCFF001RLY diencephalon (Tissue) 5159.00 19.50 14.72 100.00
ENCFF001RLZ heart (Tissue) 8992.00 34.24 8.49 100.00
ENCFF001RMA skin of body (Tissue) 3487.00 8.19 8.59 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 3896.00 14.22 12.57 100.00
ENCFF001RMC temporal lobe (Tissue) 5006.00 6.69 10.25 100.00
ENCFF001RMD uterus (Tissue) 3124.00 6.10 5.17 100.00
ENCFF001RME occipital lobe (Tissue) 3640.00 23.91 7.71 100.00
ENCFF001RMF metanephros (Tissue) 7981.00 16.80 14.85 100.00
ENCFF001RMG parietal lobe (Tissue) 9215.00 18.51 39.17 100.00
ENCFF001RMH lung (Tissue) 2111.00 10.31 4.79 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 2377.00 14.94 10.31 100.00
ENCFF001RMJ skin of body (Tissue) 1818.00 6.21 4.73 100.00
ENCFF001RMK heart (Tissue) 5581.00 27.35 9.69 100.00
ENCFF001RML cerebellum (Tissue) 11701.00 23.92 21.64 100.00
ENCFF001RMM frontal cortex (Tissue) 3247.00 13.20 5.35 100.00
ENCFF001RMN uterus (Tissue) 5058.00 9.07 9.66 100.00
ENCFF001RMO cerebellum (Tissue) 4109.00 14.09 7.93 100.00
ENCFF001RMP frontal cortex (Tissue) 6996.00 19.73 11.16 100.00
ENCFF001RMQ lung (Tissue) 3289.00 11.00 4.95 100.00
ENCFF001RMR thyroid gland (Tissue) 1048.00 2.73 2.33 100.00
ENCFF001RMS diencephalon (Tissue) 6465.00 20.22 13.41 100.00
ENCFF001RMT thyroid gland (Tissue) 872.00 2.13 1.15 100.00
ENCFF001RMU metanephros (Tissue) 1183.00 10.96 2.48 100.00
ENCFF001RMV tongue (Tissue) 4688.00 5.39 9.14 100.00
ENCFF001RTT urinary bladder (Tissue) 2363.00 9.38 6.37 100.00
ENCFF001RTU liver (Tissue) 11373.00 19.16 33.90 100.00
ENCFF004BLT GM23338 (Cell line) 1984.00 18.32 2.38 100.00
ENCFF004YAN Karpas-422 (Cell line) 1248.00 2.76 8.70 100.00
ENCFF023EVA A375 (Cell line) 141.00 5.37 0.97 100.00
ENCFF062TYF GM23248 (Cell line) 44.00 2.44 1.88 100.00
ENCFF073SVL transverse colon (Tissue) 4.00 0.09 0.02 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 85.00 1.42 0.07 100.00
ENCFF222USQ smooth muscle cell (In vitro differentiated cells) 9.00 0.04 0.01 100.00
ENCFF226BCZ Karpas-422 (Cell line) 305.00 1.23 2.01 100.00
ENCFF295DXJ smooth muscle cell (In vitro differentiated cells) 87.00 0.42 0.10 100.00
ENCFF299ETH OCI-LY7 (Cell line) 1008.00 4.43 10.44 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 1.00 0.02 0.00 100.00
ENCFF450POH GM23338 (Cell line) 180.00 2.89 1.39 100.00
ENCFF476SLG A375 (Cell line) 114.00 4.62 0.93 100.00
ENCFF518LYU hepatocyte (In vitro differentiated cells) 4.00 0.03 0.00 100.00
ENCFF521RDG OCI-LY7 (Cell line) 1152.00 5.20 11.69 100.00
ENCFF540WGH HT-29 (Cell line) 135.00 8.74 1.62 100.00
ENCFF590YKZ GM23248 (Cell line) 99.00 5.07 1.93 100.00
ENCFF686BEE adrenal gland (Tissue) 3.00 0.07 0.02 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 2.00 0.07 0.01 100.00
ENCFF834CUR HT-29 (Cell line) 105.00 3.62 1.38 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 1.00 0.03 0.00 100.00
ENCFF964DUY hepatocyte (In vitro differentiated cells) 99.00 0.59 0.11 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 11.00 0.25 0.01 100.00

RNA secondary structure