sncRNA detail

ENST00000489392.1_110_189_+

Derived from ENST00000489392.1 • Homo Sapiens

65 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
RPL7A-207
Gene
RPL7A (ENSG00000148303.17)
Precursor type
protein coding CDS not defined
Sequence
TTTGTGTGCAGATGATGTAAAAGAATATTTGCTATCTGAGAGATGGTGATGACATTTTAAACCACCAAGATCGCTGATGC
Start
Start: 110
End
End: 189
Length
Length: 80
Expression (sum)
489957.00
Expression fraction
23.36
Expression (Avg non-zero)
7537.80
Expression (max)
44849.00
Expression (CPM sum)
12.44
Expression (CPM avg non-zero)
39.15
Expression (CPM max)
947.44
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
RPL7A-207
Transcript ID
ENST00000489392.1
Chromosome
chr9
Genomic start
133348937
Genomic end
133351385

Gene context

Gene name
RPL7A
Gene ID
ENSG00000148303.17
Gene type
protein_coding

Expression table

Showing 65 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 9340.00 55.93 956.94 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 5190.00 39.36 434.22 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 4908.00 35.30 303.03 100.00
ENCFF000JEH fibroblast of the aortic adventitia (Primary cell) 4259.00 41.51 292.50 100.00
ENCFF000JEI fibroblast of the aortic adventitia (Primary cell) 7854.00 36.97 415.08 100.00
ENCFF000JEU thoracic aorta endothelial cell (Primary cell) 6309.00 64.85 483.41 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 7416.00 51.00 666.71 100.00
ENCFF000JFN articular chondrocyte of knee joint (Primary cell) 7712.00 55.85 661.50 100.00
ENCFF000JGN articular chondrocyte of knee joint (Primary cell) 7502.00 65.82 706.07 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 7354.00 62.86 779.43 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 16720.00 64.33 888.31 100.00
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 36403.00 73.10 1493.35 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 261.00 24.55 86.94 100.00
ENCFF000JJV mesenchymal stem cell of adipose (Primary cell) 41936.00 71.54 1374.28 100.00
ENCFF000JKK mesenchymal stem cell of Wharton's jelly (Primary cell) 10137.00 65.79 607.96 100.00
ENCFF000JKT mesenchymal stem cell of Wharton's jelly (Primary cell) 11982.00 63.34 608.41 100.00
ENCFF000JKU osteoblast (Primary cell) 362.00 15.86 116.96 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 11410.00 64.69 704.13 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 18431.00 49.16 656.53 100.00
ENCFF000JLG osteoblast (Primary cell) 3007.00 39.99 288.27 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 16021.00 42.54 360.56 100.00
ENCFF000JLU placental pericyte (Primary cell) 6976.00 74.24 854.33 100.00
ENCFF000JLV placental pericyte (Primary cell) 44849.00 69.92 947.44 100.00
ENCFF000JMQ placental epithelial cell (Primary cell) 7392.00 44.96 320.07 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 23238.00 62.52 512.17 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 11955.00 61.95 350.94 100.00
ENCFF000JNK vein endothelial cell (Primary cell) 17682.00 63.10 501.93 100.00
ENCFF000JNS fibroblast of villous mesenchyme (Primary cell) 5014.00 77.10 989.29 100.00
ENCFF000JOD fibroblast of villous mesenchyme (Primary cell) 4735.00 75.75 731.59 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 33755.00 75.01 879.58 100.00
ENCFF000JOR subcutaneous preadipocyte (Primary cell) 31242.00 70.86 530.39 100.00
ENCFF000JQC IMR-90 (Cell line) 281.00 31.08 481.88 100.00
ENCFF000JQE IMR-90 (Cell line) 357.00 44.13 382.51 100.00
ENCFF000KCE fibroblast of dermis (Primary cell) 13768.00 66.65 957.85 100.00
ENCFF000KCV fibroblast of dermis (Primary cell) 7477.00 63.43 954.81 100.00
ENCFF000KEC melanocyte of skin (Primary cell) 4626.00 50.26 409.40 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 2503.00 53.32 218.47 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 16693.00 60.81 818.98 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 7306.00 59.03 475.96 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 7256.00 72.06 780.60 100.00
ENCFF000KHC SK-N-SH (Cell line) 5995.00 41.01 2011.88 100.00
ENCFF000KIC SK-N-SH (Cell line) 2310.00 37.07 615.57 100.00
ENCFF001REE GM12878 (Cell line) 1.00 0.00 0.00 100.00
ENCFF001REL K562 (Cell line) 2.00 0.00 0.00 100.00
ENCFF001REQ K562 (Cell line) 1.00 0.00 0.00 100.00
ENCFF001RER GM12878 (Cell line) 2.00 0.00 0.00 100.00
ENCFF001RLW occipital lobe (Tissue) 2.00 0.02 0.01 100.00
ENCFF001RLZ heart (Tissue) 1.00 0.01 0.00 100.00
ENCFF001RMD uterus (Tissue) 1.00 0.01 0.00 100.00
ENCFF001RME occipital lobe (Tissue) 1.00 0.01 0.00 100.00
ENCFF001RMF metanephros (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMG parietal lobe (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMN uterus (Tissue) 1.00 0.01 0.00 100.00
ENCFF001RMO cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMT thyroid gland (Tissue) 1.00 0.00 0.00 100.00
ENCFF004BLT GM23338 (Cell line) 1.00 0.00 0.00 100.00
ENCFF073SVL transverse colon (Tissue) 3.00 0.02 0.01 100.00
ENCFF193XIP neural progenitor cell (In vitro differentiated cells) 1.00 0.00 0.00 100.00
ENCFF299ETH OCI-LY7 (Cell line) 2.00 0.01 0.02 100.00
ENCFF429ILE esophagus squamous epithelium (Tissue) 1.00 0.01 0.00 100.00
ENCFF521RDG OCI-LY7 (Cell line) 4.00 0.02 0.04 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 1.00 0.01 0.00 100.00
ENCFF834CUR HT-29 (Cell line) 1.00 0.01 0.01 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 1.00 0.01 0.00 100.00
ENCFF994BMY neural progenitor cell (In vitro differentiated cells) 2.00 0.00 0.00 100.00

RNA secondary structure