sncRNA detail

ENST00000582320.4_575_600_+

Derived from ENST00000582320.4 Homo Sapiens

71 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
ENST00000582320
Gene
ENSG00000264066 (ENSG00000264066.8)
Precursor type
lncRNA
Sequence
AAACCGTTACCATTACTGAGTTTAGT
Start
Start: 575
End
End: 600
Length
Length: 26
Expression (sum)
126624.00
Expression fraction
8.94
Expression (Avg non-zero)
1783.44
Expression (max)
22333.00
Expression (CPM sum)
3.21
Expression (CPM avg non-zero)
5.10
Expression (CPM max)
66.57
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
ENST00000582320
Transcript ID
ENST00000582320.4
Chromosome
chr17
Genomic start
28860897
Genomic end
28861998

Gene context

Gene name
ENSG00000264066
Gene ID
ENSG00000264066.8
Gene type
lncRNA

Expression table

Showing 71 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF001REE GM12878 (Cell line) 1.00 2.44 0.00 100.00
ENCFF001REL K562 (Cell line) 1624.00 12.68 3.02 100.00
ENCFF001REQ K562 (Cell line) 2015.00 6.87 5.11 100.00
ENCFF001RER GM12878 (Cell line) 3.00 8.82 0.01 100.00
ENCFF001RLS parietal lobe (Tissue) 497.00 5.99 1.76 100.00
ENCFF001RLT temporal lobe (Tissue) 852.00 7.37 1.41 100.00
ENCFF001RLU spinal cord (Tissue) 1371.00 7.21 4.66 100.00
ENCFF001RLV tongue (Tissue) 824.00 4.62 2.24 100.00
ENCFF001RLW occipital lobe (Tissue) 286.00 8.84 0.93 100.00
ENCFF001RLX spinal cord (Tissue) 12297.00 7.28 22.55 100.00
ENCFF001RLY diencephalon (Tissue) 502.00 8.18 1.43 100.00
ENCFF001RLZ heart (Tissue) 2254.00 8.31 2.13 100.00
ENCFF001RMA skin of body (Tissue) 8250.00 9.74 20.32 100.00
ENCFF001RMB skeletal muscle tissue (Tissue) 13104.00 8.96 42.29 100.00
ENCFF001RMC temporal lobe (Tissue) 748.00 5.62 1.53 100.00
ENCFF001RMD uterus (Tissue) 9460.00 10.06 15.65 100.00
ENCFF001RME occipital lobe (Tissue) 439.00 9.19 0.93 100.00
ENCFF001RMF metanephros (Tissue) 573.00 10.40 1.07 100.00
ENCFF001RMG parietal lobe (Tissue) 118.00 6.47 0.50 100.00
ENCFF001RMH lung (Tissue) 2673.00 6.67 6.06 100.00
ENCFF001RMI skeletal muscle tissue (Tissue) 2779.00 8.03 12.05 100.00
ENCFF001RMJ skin of body (Tissue) 10884.00 8.87 28.30 100.00
ENCFF001RMK heart (Tissue) 1740.00 10.30 3.02 100.00
ENCFF001RML cerebellum (Tissue) 804.00 9.47 1.49 100.00
ENCFF001RMM frontal cortex (Tissue) 567.00 9.99 0.93 100.00
ENCFF001RMN uterus (Tissue) 850.00 9.74 1.62 100.00
ENCFF001RMO cerebellum (Tissue) 1858.00 8.61 3.59 100.00
ENCFF001RMP frontal cortex (Tissue) 349.00 9.84 0.56 100.00
ENCFF001RMQ lung (Tissue) 5464.00 11.41 8.23 100.00
ENCFF001RMR thyroid gland (Tissue) 10925.00 6.16 24.28 100.00
ENCFF001RMS diencephalon (Tissue) 587.00 8.88 1.22 100.00
ENCFF001RMT thyroid gland (Tissue) 3216.00 4.93 4.24 100.00
ENCFF001RMU metanephros (Tissue) 3595.00 9.48 7.54 100.00
ENCFF001RMV tongue (Tissue) 980.00 4.82 1.91 100.00
ENCFF001RTT urinary bladder (Tissue) 1281.00 7.93 3.45 100.00
ENCFF001RTU liver (Tissue) 22333.00 23.21 66.57 100.00
ENCFF015UJX spleen (Tissue) 20.00 0.73 0.11 100.00
ENCFF059WHB prostate gland (Tissue) 150.00 1.84 0.56 100.00
ENCFF076JME ovary (Tissue) 6.00 3.00 0.03 100.00
ENCFF192PKY upper lobe of left lung (Tissue) 30.00 3.37 0.18 100.00
ENCFF211GIU transverse colon (Tissue) 2.00 1.82 0.01 100.00
ENCFF261XRS stomach (Tissue) 7.00 2.10 0.03 100.00
ENCFF274FTM prostate gland (Tissue) 5.00 4.46 0.02 100.00
ENCFF276PUU mesenchymal stem cell (In vitro differentiated cells) 1.00 10.00 0.00 100.00
ENCFF310THB vagina (Tissue) 8.00 1.93 0.03 100.00
ENCFF316MTC trophoblast cell (In vitro differentiated cells) 6.00 8.57 0.04 100.00
ENCFF379KTQ stomach (Tissue) 1.00 0.87 0.00 100.00
ENCFF381DXM transverse colon (Tissue) 2.00 1.57 0.01 100.00
ENCFF400GBK spleen (Tissue) 23.00 0.90 0.11 100.00
ENCFF476IAU esophagus squamous epithelium (Tissue) 3.00 1.76 0.01 100.00
ENCFF495VAK Peyer's patch (Tissue) 1.00 3.85 0.00 100.00
ENCFF503PBD mesendoderm (In vitro differentiated cells) 5.00 4.10 0.05 100.00
ENCFF516CUT adrenal gland (Tissue) 1.00 1.06 0.01 100.00
ENCFF534JKI spleen (Tissue) 20.00 1.12 0.08 100.00
ENCFF546NNZ uterus (Tissue) 1.00 2.63 0.00 100.00
ENCFF643IED upper lobe of left lung (Tissue) 68.00 1.61 0.50 100.00
ENCFF655CDV sigmoid colon (Tissue) 1.00 0.56 0.00 100.00
ENCFF657CXK esophagus muscularis mucosa (Tissue) 7.00 1.47 0.03 100.00
ENCFF682YQJ spleen (Tissue) 42.00 3.02 0.20 100.00
ENCFF685KEG stomach (Tissue) 2.00 0.44 0.01 100.00
ENCFF694VGD upper lobe of left lung (Tissue) 44.00 1.21 0.25 100.00
ENCFF714LDG trophoblast cell (In vitro differentiated cells) 4.00 6.35 0.03 100.00
ENCFF720JFQ mesendoderm (In vitro differentiated cells) 4.00 3.20 0.04 100.00
ENCFF768XBE upper lobe of left lung (Tissue) 31.00 1.52 0.22 100.00
ENCFF797VVQ esophagus muscularis mucosa (Tissue) 8.00 2.92 0.05 100.00
ENCFF800ZUT tibial nerve (Tissue) 3.00 1.53 0.02 100.00
ENCFF811DGS gastroesophageal sphincter (Tissue) 3.00 9.68 0.01 100.00
ENCFF853XSN Peyer's patch (Tissue) 7.00 11.11 0.02 100.00
ENCFF903MJZ subcutaneous adipose tissue (Tissue) 2.00 2.94 0.01 100.00
ENCFF908XAD omental fat pad (Tissue) 2.00 0.66 0.00 100.00
ENCFF936FXF neuronal stem cell (In vitro differentiated cells) 1.00 3.33 0.01 100.00

RNA secondary structure