sncRNA detail

ENST00000651540.1_1_88_+

Derived from ENST00000651540.1 Homo Sapiens

56 libraries

sncRNA snapshot

Organism
Homo Sapiens
Precursor
ENST00000651540
Gene
ENSG00000286171 (ENSG00000286171.1)
Precursor type
lncRNA
Sequence
AACACAGTTGGTCCGAGTGTTGTGGGTTATTGTTAAGTTGATTTAACATTGTCTCCCCCCACAACCGCGCTTGACTAGCTTGCTGTTT
Start
Start: 1
End
End: 88
Length
Length: 88
Expression (sum)
305669.00
Expression fraction
3.50
Expression (Avg non-zero)
5458.38
Expression (max)
109436.00
Expression (CPM sum)
7.80
Expression (CPM avg non-zero)
38.91
Expression (CPM max)
9155.92
Prominence
100.0

Genomic Context

Precursor and gene context

Precursor overview

Transcript name
ENST00000651540
Transcript ID
ENST00000651540.1
Chromosome
chr7
Genomic start
148941483
Genomic end
148941638

Gene context

Gene name
ENSG00000286171
Gene ID
ENSG00000286171.1
Gene type
lncRNA

Expression table

Showing 56 linked libraries
Library Biosample Expression Expression fraction Expression (CPM) Prominence
ENCFF000IZM hematopoietic multipotent progenitor cell (In vitro differentiated cells) 3072.00 81.29 314.74 100.00
ENCFF000JEC neural cell (In vitro differentiated cells) 109436.00 84.79 9155.92 100.00
ENCFF000JEF neural cell (In vitro differentiated cells) 62274.00 81.11 3844.90 100.00
ENCFF000JEH fibroblast of the aortic adventitia (Primary cell) 1881.00 71.36 129.18 100.00
ENCFF000JEI fibroblast of the aortic adventitia (Primary cell) 2368.00 72.22 125.15 100.00
ENCFF000JEU thoracic aorta endothelial cell (Primary cell) 1169.00 71.19 89.57 100.00
ENCFF000JFM thoracic aorta endothelial cell (Primary cell) 1121.00 68.86 100.78 100.00
ENCFF000JFN articular chondrocyte of knee joint (Primary cell) 1533.00 66.83 131.49 100.00
ENCFF000JGN articular chondrocyte of knee joint (Primary cell) 1182.00 61.31 111.25 100.00
ENCFF000JIX hair follicle dermal papilla cell (Primary cell) 1203.00 63.35 127.50 100.00
ENCFF000JJB hair follicle dermal papilla cell (Primary cell) 1078.00 65.45 57.27 100.00
ENCFF000JJI mesenchymal stem cell of adipose (Primary cell) 3062.00 58.52 125.61 100.00
ENCFF000JJT mammary epithelial cell (Primary cell) 1965.00 82.08 654.57 100.00
ENCFF000JJV mesenchymal stem cell of adipose (Primary cell) 2624.00 58.00 85.99 100.00
ENCFF000JKK mesenchymal stem cell of Wharton's jelly (Primary cell) 6109.00 76.65 366.38 100.00
ENCFF000JKT mesenchymal stem cell of Wharton's jelly (Primary cell) 2919.00 73.53 148.22 100.00
ENCFF000JKU osteoblast (Primary cell) 250.00 64.94 80.78 100.00
ENCFF000KEF melanocyte of skin (Primary cell) 5406.00 69.84 333.61 100.00
ENCFF000JLA mesenchymal stem cell of the bone marrow (Primary cell) 7378.00 75.97 262.81 100.00
ENCFF000JLG osteoblast (Primary cell) 904.00 75.59 86.66 100.00
ENCFF000JLH mesenchymal stem cell of the bone marrow (Primary cell) 19828.00 78.90 446.24 100.00
ENCFF000JLU placental pericyte (Primary cell) 1004.00 78.56 122.96 100.00
ENCFF000JLV placental pericyte (Primary cell) 3457.00 73.41 73.03 100.00
ENCFF000JMQ placental epithelial cell (Primary cell) 8863.00 76.10 383.76 100.00
ENCFF000JMV placental epithelial cell (Primary cell) 4725.00 71.88 104.14 100.00
ENCFF000JNF vein endothelial cell (Primary cell) 4381.00 75.16 128.61 100.00
ENCFF000JNK vein endothelial cell (Primary cell) 3667.00 78.15 104.09 100.00
ENCFF000JNS fibroblast of villous mesenchyme (Primary cell) 1021.00 74.25 201.45 100.00
ENCFF000JOD fibroblast of villous mesenchyme (Primary cell) 982.00 67.86 151.73 100.00
ENCFF000JOQ subcutaneous preadipocyte (Primary cell) 3534.00 76.61 92.09 100.00
ENCFF000JOR subcutaneous preadipocyte (Primary cell) 4344.00 75.14 73.75 100.00
ENCFF000JQC IMR-90 (Cell line) 1800.00 73.95 3086.81 100.00
ENCFF000JQE IMR-90 (Cell line) 1413.00 79.43 1513.98 100.00
ENCFF000KCE fibroblast of dermis (Primary cell) 1644.00 71.51 114.37 100.00
ENCFF000KCV fibroblast of dermis (Primary cell) 2025.00 69.76 258.59 100.00
ENCFF000KEC melanocyte of skin (Primary cell) 3381.00 65.32 299.22 100.00
ENCFF000KEJ melanocyte of skin (Primary cell) 5118.00 70.51 446.71 100.00
ENCFF000KFC melanocyte of skin (Primary cell) 6602.00 73.86 323.90 100.00
ENCFF000KFJ skeletal muscle satellite cell (Primary cell) 2519.00 72.26 164.10 100.00
ENCFF000KFO skeletal muscle satellite cell (Primary cell) 1690.00 73.73 181.81 100.00
ENCFF000KHC SK-N-SH (Cell line) 3728.00 77.44 1251.09 100.00
ENCFF000KIC SK-N-SH (Cell line) 2984.00 74.49 795.18 100.00
ENCFF001REL K562 (Cell line) 1.00 0.00 0.00 100.00
ENCFF001RLX spinal cord (Tissue) 5.00 0.00 0.01 100.00
ENCFF001RMD uterus (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMF metanephros (Tissue) 2.00 0.00 0.00 100.00
ENCFF001RMH lung (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RML cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMN uterus (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RMO cerebellum (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMQ lung (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMR thyroid gland (Tissue) 3.00 0.00 0.01 100.00
ENCFF001RMT thyroid gland (Tissue) 1.00 0.00 0.00 100.00
ENCFF001RMV tongue (Tissue) 2.00 0.00 0.00 100.00
ENCFF001RTU liver (Tissue) 1.00 0.00 0.00 100.00
ENCFF004YAN Karpas-422 (Cell line) 2.00 0.00 0.01 100.00

RNA secondary structure